Class: water MIGS eukaryote

Combinatorial checklist Minimal Information about a Genome Sequence: eukaryote with environmental package water

URI: mixs.vocab:WaterMIGSEukaryote

Parents

• is_a: Water - water

Uses Mixin

• mixin: MIGSEukaryote - Minimal Information about a Genome Sequence: eukaryote

Attributes

Inherited from water:

• lat_lon _0..1
  • Description: The geographical origin of the sample as defined by latitude and longitude. The values should be reported in decimal degrees and in WGS84 system
  • Range: String
  • Example: 50.586825 6.408977 None
• water➞depth _1..1
  • Description: The vertical distance below local surface, e.g. for sediment or soil samples depth is measured from sediment or soil surface, respectively. Depth can be reported as an interval for subsurface samples.
  • Range: QuantityValue
  • Example: 10 meter None
• alt _0..1
  • Description: Altitude is a term used to identify heights of objects such as airplanes, space shuttles, rockets, atmospheric balloons and heights of places such as atmospheric layers and clouds. It is used to measure the height of an object which is above the earth's surface. In this context, the altitude measurement is the vertical distance between the earth's surface above sea level and the sampled position in the air
  • Range: QuantityValue
  • Example: 100 meter None
• water➞elev _0..1
  • Description: Elevation of the sampling site is its height above a fixed reference point, most commonly the mean sea level. Elevation is mainly used when referring to points on the earth's surface, while altitude is used for points above the surface, such as an aircraft in flight or a spacecraft in orbit.
  • Range: QuantityValue
  • Example: 100 meter None
• water➞temp _0..1
  • Description: Temperature of the sample at the time of sampling.
  • Range: QuantityValue
  • Example: 25 degree Celsius None
• geo_loc_name _0..1
  • Description: The geographical origin of the sample as defined by the country or sea name followed by specific region name. Country or sea names should be chosen from the INSDC country list (http://insdc.org/country.html), or the GAZ ontology (http://purl.bioontology.org/ontology/GAZ)
  • Range: String
  • Example: USA: Maryland, Bethesda None
• collection_date _0..1
  • Description: The time of sampling, either as an instance (single point in time) or interval. In case no exact time is available, the date/time can be right truncated i.e. all of these are valid times: 2008-01-23T19:23:10+00:00; 2008-01-23T19:23:10; 2008-01-23; 2008-01; 2008; Except: 2008-01; 2008 all are ISO8601 compliant
  • Range: Date
  • Example: 2018-05-11T10:00:00+01:00; 2018-05-11 None
• env_broad_scale _0..1
  • Description: Report the major environmental system the sample or specimen came from. The system(s) identified should have a coarse spatial grain, to provide the general environmental context of where the sampling was done (e.g. in the desert or a rainforest). We recommend using subclasses of EnvO’s biome class: http://purl.obolibrary.org/obo/ENVO_00000428. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS
  • Range: String
  • Example: oceanic epipelagic zone biome [ENVO:01000033] for annotating a water sample from the photic zone in middle of the Atlantic Ocean None
• env_local_scale _0..1
  • Description: Report the entity or entities which are in the sample or specimen’s local vicinity and which you believe have significant causal influences on your sample or specimen. We recommend using EnvO terms which are of smaller spatial grain than your entry for env_broad_scale. Terms, such as anatomical sites, from other OBO Library ontologies which interoperate with EnvO (e.g. UBERON) are accepted in this field. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS.
  • Range: String
  • Example: litter layer [ENVO:01000338]; Annotating a pooled sample taken from various vegetation layers in a forest consider: canopy [ENVO:00000047]|herb and fern layer [ENVO:01000337]|litter layer [ENVO:01000338]|understory [01000335]|shrub layer [ENVO:01000336]. None
• env_medium _0..1
  • Description: Report the environmental material(s) immediately surrounding the sample or specimen at the time of sampling. We recommend using subclasses of 'environmental material' (http://purl.obolibrary.org/obo/ENVO_00010483). EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS . Terms from other OBO ontologies are permissible as long as they reference mass/volume nouns (e.g. air, water, blood) and not discrete, countable entities (e.g. a tree, a leaf, a table top).
  • Range: String
  • Example: soil [ENVO:00001998]; Annotating a fish swimming in the upper 100 m of the Atlantic Ocean, consider: ocean water [ENVO:00002151]. Example: Annotating a duck on a pond consider: pond water [ENVO:00002228]|air [ENVO_00002005] None
• water➞alkalinity _0..1
  • Description: Alkalinity, the ability of a solution to neutralize acids to the equivalence point of carbonate or bicarbonate
  • Range: QuantityValue
  • Example: 50 milligram per liter None
• water➞alkalinity_method _0..1
  • Description: Method used for alkalinity measurement
  • Range: String
  • Example: titration None
• water➞alkyl_diethers _0..1
  • Description: Concentration of alkyl diethers
  • Range: QuantityValue
  • Example: 0.005 mole per liter None
• water➞aminopept_act _0..1
  • Description: Measurement of aminopeptidase activity
  • Range: QuantityValue
  • Example: 0.269 mole per liter per hour None
• water➞ammonium _0..1
  • Description: Concentration of ammonium in the sample
  • Range: QuantityValue
  • Example: 1.5 milligram per liter None
• water➞atmospheric_data _0..*
  • Description: Measurement of atmospheric data; can include multiple data
  • Range: String
  • Example: wind speed;9 knots None
• water➞bacteria_carb_prod _0..1
  • Description: Measurement of bacterial carbon production
  • Range: QuantityValue
  • Example: 2.53 microgram per liter per hour None
• water➞bac_prod _0..1
  • Description: Bacterial production in the water column measured by isotope uptake
  • Range: QuantityValue
  • Example: 5 milligram per cubic meter per day None
• water➞bac_resp _0..1
  • Description: Measurement of bacterial respiration in the water column
  • Range: QuantityValue
  • Example: 300 micromole oxygen per liter per hour None
• water➞biomass _0..*
  • Description: Amount of biomass; should include the name for the part of biomass measured, e.g. Microbial, total. Can include multiple measurements
  • Range: String
  • Example: total;20 gram None
• water➞bishomohopanol _0..1
  • Description: Concentration of bishomohopanol
  • Range: QuantityValue
  • Example: 14 microgram per liter None
• water➞bromide _0..1
  • Description: Concentration of bromide
  • Range: QuantityValue
  • Example: 0.05 parts per million None
• water➞calcium _0..1
  • Description: Concentration of calcium in the sample
  • Range: QuantityValue
  • Example: 0.2 micromole per liter None
• water➞carb_nitro_ratio _0..1
  • Description: Ratio of amount or concentrations of carbon to nitrogen
  • Range: QuantityValue
  • Example: 0.417361111 None
• water➞chem_administration _0..*
  • Description: List of chemical compounds administered to the host or site where sampling occurred, and when (e.g. Antibiotics, n fertilizer, air filter); can include multiple compounds. For chemical entities of biological interest ontology (chebi) (v 163), http://purl.bioontology.org/ontology/chebi
  • Range: String
  • Example: agar [CHEBI:2509];2018-05-11T20:00Z None
• water➞chloride _0..1
  • Description: Concentration of chloride in the sample
  • Range: QuantityValue
  • Example: 5000 milligram per liter None
• water➞chlorophyll _0..1
  • Description: Concentration of chlorophyll
  • Range: QuantityValue
  • Example: 5 milligram per cubic meter None
• water➞conduc _0..1
  • Description: Electrical conductivity of water
  • Range: QuantityValue
  • Example: 10 milliSiemens per centimeter None
• water➞density _0..1
  • Description: Density of the sample, which is its mass per unit volume (aka volumetric mass density)
  • Range: QuantityValue
  • Example: 1000 kilogram per cubic meter None
• water➞diether_lipids _0..*
  • Description: Concentration of diether lipids; can include multiple types of diether lipids
  • Range: String
  • Example: 0.2 nanogram per liter None
• water➞diss_carb_dioxide _0..1
  • Description: Concentration of dissolved carbon dioxide in the sample or liquid portion of the sample
  • Range: QuantityValue
  • Example: 5 milligram per liter None
• water➞diss_hydrogen _0..1
  • Description: Concentration of dissolved hydrogen
  • Range: QuantityValue
  • Example: 0.3 micromole per liter None
• water➞diss_inorg_carb _0..1
  • Description: Dissolved inorganic carbon concentration in the sample, typically measured after filtering the sample using a 0.45 micrometer filter
  • Range: QuantityValue
  • Example: 2059 micromole per kilogram None
• water➞diss_inorg_nitro _0..1
  • Description: Concentration of dissolved inorganic nitrogen
  • Range: QuantityValue
  • Example: 761 micromole per liter None
• water➞diss_inorg_phosp _0..1
  • Description: Concentration of dissolved inorganic phosphorus in the sample
  • Range: QuantityValue
  • Example: 56.5 micromole per liter None
• water➞diss_org_carb _0..1
  • Description: Concentration of dissolved organic carbon in the sample, liquid portion of the sample, or aqueous phase of the fluid
  • Range: QuantityValue
  • Example: 197 micromole per liter None
• water➞diss_org_nitro _0..1
  • Description: Dissolved organic nitrogen concentration measured as; total dissolved nitrogen - NH4 - NO3 - NO2
  • Range: QuantityValue
  • Example: 0.05 micromole per liter None
• water➞diss_oxygen _0..1
  • Description: Concentration of dissolved oxygen
  • Range: QuantityValue
  • Example: 175 micromole per kilogram None
• water➞down_par _0..1
  • Description: Visible waveband radiance and irradiance measurements in the water column
  • Range: QuantityValue
  • Example: 28.71 microEinstein per square meter per second None
• water➞fluor _0..1
  • Description: Raw or converted fluorescence of water
  • Range: QuantityValue
  • Example: 2.5 volts None
• water➞glucosidase_act _0..1
  • Description: Measurement of glucosidase activity
  • Range: QuantityValue
  • Example: 5 mol per liter per hour None
• water➞light_intensity _0..1
  • Description: Measurement of light intensity
  • Range: QuantityValue
  • Example: 0.3 lux None
• water➞magnesium _0..1
  • Description: Concentration of magnesium in the sample
  • Range: QuantityValue
  • Example: 52.8 micromole per kilogram None
• water➞mean_frict_vel _0..1
  • Description: Measurement of mean friction velocity
  • Range: QuantityValue
  • Example: 0.5 meter per second None
• water➞mean_peak_frict_vel _0..1
  • Description: Measurement of mean peak friction velocity
  • Range: QuantityValue
  • Example: 1 meter per second None
• water➞misc_param _0..*
  • Description: Any other measurement performed or parameter collected, that is not listed here
  • Range: String
  • Example: Bicarbonate ion concentration;2075 micromole per kilogram None
• water➞n_alkanes _0..*
  • Description: Concentration of n-alkanes; can include multiple n-alkanes
  • Range: String
  • Example: n-hexadecane;100 milligram per liter None
• water➞nitrate _0..1
  • Description: Concentration of nitrate in the sample
  • Range: QuantityValue
  • Example: 65 micromole per liter None
• water➞nitrite _0..1
  • Description: Concentration of nitrite in the sample
  • Range: QuantityValue
  • Example: 0.5 micromole per liter None
• water➞nitro _0..1
  • Description: Concentration of nitrogen (total)
  • Range: QuantityValue
  • Example: 4.2 micromole per liter None
• water➞org_carb _0..1
  • Description: Concentration of organic carbon
  • Range: QuantityValue
  • Example: 1.5 microgram per liter None
• water➞org_matter _0..1
  • Description: Concentration of organic matter
  • Range: QuantityValue
  • Example: 1.75 milligram per cubic meter None
• water➞org_nitro _0..1
  • Description: Concentration of organic nitrogen
  • Range: QuantityValue
  • Example: 4 micromole per liter None
• water➞organism_count _0..*
  • Description: Total cell count of any organism (or group of organisms) per gram, volume or area of sample, should include name of organism followed by count. The method that was used for the enumeration (e.g. qPCR, atp, mpn, etc.) Should also be provided. (example: total prokaryotes; 3.5e7 cells per ml; qpcr)
  • Range: organism_count_enum
  • Example: total prokaryotes;3.5e7 cells per milliliter;qPCR None
• water➞oxy_stat_samp _0..1
  • Description: Oxygenation status of sample
  • Range: oxy_stat_samp_enum
  • Example: aerobic None
• water➞ph _0..1
  • Description: Ph measurement of the sample, or liquid portion of sample, or aqueous phase of the fluid
  • Range: Double
  • Example: 7.2 None
• water➞part_org_carb _0..1
  • Description: Concentration of particulate organic carbon
  • Range: QuantityValue
  • Example: 1.92 micromole per liter None
• water➞part_org_nitro _0..1
  • Description: Concentration of particulate organic nitrogen
  • Range: QuantityValue
  • Example: 0.3 micromole per liter None
• water➞perturbation _0..*
  • Description: Type of perturbation, e.g. chemical administration, physical disturbance, etc., coupled with perturbation regimen including how many times the perturbation was repeated, how long each perturbation lasted, and the start and end time of the entire perturbation period; can include multiple perturbation types
  • Range: String
  • Example: antibiotic addition;R2/2018-05-11T14:30Z/2018-05-11T19:30Z/P1H30M None
• water➞petroleum_hydrocarb _0..1
  • Description: Concentration of petroleum hydrocarbon
  • Range: QuantityValue
  • Example: 0.05 micromole per liter None
• water➞phaeopigments _0..*
  • Description: Concentration of phaeopigments; can include multiple phaeopigments
  • Range: String
  • Example: 2.5 milligram per cubic meter None
• water➞phosphate _0..1
  • Description: Concentration of phosphate
  • Range: QuantityValue
  • Example: 0.7 micromole per liter None
• water➞phosplipid_fatt_acid _0..*
  • Description: Concentration of phospholipid fatty acids; can include multiple values
  • Range: String
  • Example: 2.98 milligram per liter None
• water➞photon_flux _0..1
  • Description: Measurement of photon flux
  • Range: QuantityValue
  • Example: 3.926 micromole photons per second per square meter None
• water➞potassium _0..1
  • Description: Concentration of potassium in the sample
  • Range: QuantityValue
  • Example: 463 milligram per liter None
• water➞pressure _0..1
  • Description: Pressure to which the sample is subject to, in atmospheres
  • Range: QuantityValue
  • Example: 50 atmosphere None
• water➞primary_prod _0..1
  • Description: Measurement of primary production, generally measured as isotope uptake
  • Range: QuantityValue
  • Example: 100 milligram per cubic meter per day None
• water➞redox_potential _0..1
  • Description: Redox potential, measured relative to a hydrogen cell, indicating oxidation or reduction potential
  • Range: QuantityValue
  • Example: 300 millivolt None
• water➞salinity _0..1
  • Description: The total concentration of all dissolved salts in a liquid or solid sample. While salinity can be measured by a complete chemical analysis, this method is difficult and time consuming. More often, it is instead derived from the conductivity measurement. This is known as practical salinity. These derivations compare the specific conductance of the sample to a salinity standard such as seawater.
  • Range: QuantityValue
  • Example: 25 practical salinity unit None
• water➞samp_store_dur _0..1
  • Description: Duration for which the sample was stored
  • Range: String
  • Example: P1Y6M None
• water➞samp_store_loc _0..1
  • Description: Location at which sample was stored, usually name of a specific freezer/room
  • Range: String
  • Example: Freezer no:5 None
• water➞samp_store_temp _0..1
  • Description: Temperature at which sample was stored, e.g. -80 degree Celsius
  • Range: QuantityValue
  • Example: -80 degree Celsius None
• water➞silicate _0..1
  • Description: Concentration of silicate
  • Range: QuantityValue
  • Example: 0.05 micromole per liter None
• water➞size_frac_low _0..1
  • Description: Refers to the mesh/pore size used to pre-filter/pre-sort the sample. Materials larger than the size threshold are excluded from the sample
  • Range: QuantityValue
  • Example: 0.2 micrometer None
• water➞size_frac_up _0..1
  • Description: Refers to the mesh/pore size used to retain the sample. Materials smaller than the size threshold are excluded from the sample
  • Range: QuantityValue
  • Example: 20 micrometer None
• water➞sodium _0..1
  • Description: Sodium concentration in the sample
  • Range: QuantityValue
  • Example: 10.5 milligram per liter None
• water➞soluble_react_phosp _0..1
  • Description: Concentration of soluble reactive phosphorus
  • Range: QuantityValue
  • Example: 0.1 milligram per liter None
• water➞sulfate _0..1
  • Description: Concentration of sulfate in the sample
  • Range: QuantityValue
  • Example: 5 micromole per liter None
• water➞sulfide _0..1
  • Description: Concentration of sulfide in the sample
  • Range: QuantityValue
  • Example: 2 micromole per liter None
• water➞suspend_part_matter _0..1
  • Description: Concentration of suspended particulate matter
  • Range: QuantityValue
  • Example: 0.5 milligram per liter None
• water➞tidal_stage _0..1
  • Description: Stage of tide
  • Range: tidal_stage_enum
  • Example: high tide None
• water➞tot_depth_water_col _0..1
  • Description: Measurement of total depth of water column
  • Range: QuantityValue
  • Example: 500 meter None
• water➞tot_diss_nitro _0..1
  • Description: Total dissolved nitrogen concentration, reported as nitrogen, measured by: total dissolved nitrogen = NH4 + NO3NO2 + dissolved organic nitrogen
  • Range: QuantityValue
  • Example: 40 microgram per liter None
• water➞tot_inorg_nitro _0..1
  • Description: Total inorganic nitrogen content
  • Range: QuantityValue
  • Example: 40 microgram per liter None
• water➞tot_nitro _0..1
  • Description: Total nitrogen concentration of water samples, calculated by: total nitrogen = total dissolved nitrogen + particulate nitrogen. Can also be measured without filtering, reported as nitrogen
  • Range: QuantityValue
  • Example: 50 micromole per liter None
• water➞tot_part_carb _0..1
  • Description: Total particulate carbon content
  • Range: QuantityValue
  • Example: 35 micromole per liter None
• water➞tot_phosp _0..1
  • Description: Total phosphorus concentration in the sample, calculated by: total phosphorus = total dissolved phosphorus + particulate phosphorus
  • Range: QuantityValue
  • Example: 0.03 milligram per liter None
• water➞turbidity _0..1
  • Description: Measure of the amount of cloudiness or haziness in water caused by individual particles
  • Range: QuantityValue
  • Example: 0.3 nephelometric turbidity units None
• water➞water_current _0..1
  • Description: Measurement of magnitude and direction of flow within a fluid
  • Range: QuantityValue
  • Example: 10 cubic meter per second None
• water➞samp_name _1..1
  • Description: A local identifier or name that for the material sample used for extracting nucleic acids, and subsequent sequencing. It can refer either to the original material collected or to any derived sub-samples. It can have any format, but we suggest that you make it concise, unique and consistent within your lab, and as informative as possible. INSDC requires every sample name from a single Submitter to be unique. Use of a globally unique identifier for the field source_mat_id is recommended in addition to sample_name.
  • Range: String
  • Example: ISDsoil1 None
• water➞project_name _1..1
  • Description: Name of the project within which the sequencing was organized
  • Range: String
  • Example: Forest soil metagenome None
• water➞samp_vol_we_dna_ext _0..1
  • Description: Volume (ml) or mass (g) of total collected sample processed for DNA extraction. Note: total sample collected should be entered under the term Sample Size (MIXS:0000001).
  • Range: QuantityValue
  • Example: 1500 milliliter None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞submitted_to_insdc _1..1
  • Description: Depending on the study (large-scale e.g. done with next generation sequencing technology, or small-scale) sequences have to be submitted to SRA (Sequence Read Archive), DRA (DDBJ Read Archive) or via the classical Webin/Sequin systems to Genbank, ENA and DDBJ. Although this field is mandatory, it is meant as a self-test field, therefore it is not necessary to include this field in contextual data submitted to databases
  • Range: String
  • Example: yes None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞investigation_type _1..1
  • Description: Nucleic Acid Sequence Report is the root element of all MIGS/MIMS compliant reports as standardized by Genomic Standards Consortium. This field is either eukaryote,bacteria,virus,plasmid,organelle, metagenome,mimarks-survey, mimarks-specimen, metatranscriptome, single amplified genome, metagenome-assembled genome, or uncultivated viral genome
  • Range: investigation_type_enum
  • Example: metagenome None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞samp_taxon_id _1..1
  • Description: NCBI taxon id of the sample. Maybe be a single taxon or mixed taxa sample. Use 'synthetic metagenome’ for mock community/positive controls, or 'blank sample' for negative controls.
  • Range: String
  • Example: Gut Metagenome [NCBI:txid749906] None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞experimental_factor _0..1
  • Description: Experimental factors are essentially the variable aspects of an experiment design which can be used to describe an experiment, or set of experiments, in an increasingly detailed manner. This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). For a browser of EFO (v 2.95) terms, please see http://purl.bioontology.org/ontology/EFO; for a browser of OBI (v 2018-02-12) terms please see http://purl.bioontology.org/ontology/OBI
  • Range: String
  • Example: time series design [EFO:EFO_0001779] None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞neg_cont_type _0..1
  • Description: The substance or equipment used as a negative control in an investigation
  • Range: neg_cont_type_enum
  • Example: None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞pos_cont_type _0..1
  • Description: The substance, mixture, product, or apparatus used to verify that a process which is part of an investigation delivers a true positive.
  • Range: String
  • Example: None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞env_package _0..1
  • Description: MIxS extension for reporting of measurements and observations obtained from one or more of the environments where the sample was obtained. All environmental packages listed here are further defined in separate subtables. By giving the name of the environmental package, a selection of fields can be made from the subtables and can be reported
  • Range: env_package_enum
  • Example: soil None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞subspecf_gen_lin _0..1
  • Description: Information about the genetic distinctness of the sequenced organism below the subspecies level, e.g., serovar, serotype, biotype, ecotype, or any relevant genetic typing schemes like Group I plasmid. Subspecies should not be recorded in this term, but in the NCBI taxonomy. Supply both the lineage name and the lineage rank separated by a colon, e.g., biovar:abc123.
  • Range: String
  • Example: serovar:Newport None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞ploidy _0..1
  • Description: The ploidy level of the genome (e.g. allopolyploid, haploid, diploid, triploid, tetraploid). It has implications for the downstream study of duplicated gene and regions of the genomes (and perhaps for difficulties in assembly). For terms, please select terms listed under class ploidy (PATO:001374) of Phenotypic Quality Ontology (PATO), and for a browser of PATO (v 2018-03-27) please refer to http://purl.bioontology.org/ontology/PATO
  • Range: String
  • Example: allopolyploidy [PATO:0001379] None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞num_replicons _0..1
  • Description: Reports the number of replicons in a nuclear genome of eukaryotes, in the genome of a bacterium or archaea or the number of segments in a segmented virus. Always applied to the haploid chromosome count of a eukaryote
  • Range: Integer
  • Example: 2 None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞extrachrom_elements _0..1
  • Description: Do plasmids exist of significant phenotypic consequence (e.g. ones that determine virulence or antibiotic resistance). Megaplasmids? Other plasmids (borrelia has 15+ plasmids)
  • Range: Integer
  • Example: 5 None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞estimated_size _0..1
  • Description: The estimated size of the genome prior to sequencing. Of particular importance in the sequencing of (eukaryotic) genome which could remain in draft form for a long or unspecified period.
  • Range: String
  • Example: 300000 bp None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞ref_biomaterial _0..1
  • Description: Primary publication if isolated before genome publication; otherwise, primary genome report.
  • Range: String
  • Example: doi:10.1016/j.syapm.2018.01.009 None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞source_mat_id _0..1
  • Description: A unique identifier assigned to a material sample (as defined by http://rs.tdwg.org/dwc/terms/materialSampleID, and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing. The identifier can refer either to the original material collected or to any derived sub-samples. The INSDC qualifiers /specimen_voucher, /bio_material, or /culture_collection may or may not share the same value as the source_mat_id field. For instance, the /specimen_voucher qualifier and source_mat_id may both contain 'UAM:Herps:14' , referring to both the specimen voucher and sampled tissue with the same identifier. However, the /culture_collection qualifier may refer to a value from an initial culture (e.g. ATCC:11775) while source_mat_id would refer to an identifier from some derived culture from which the nucleic acids were extracted (e.g. xatc123 or ark:/2154/R2).
  • Range: String
  • Example: MPI012345 None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞pathogenicity _0..1
  • Description: To what is the entity pathogenic
  • Range: String
  • Example: human, animal, plant, fungi, bacteria None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞biotic_relationship _0..1
  • Description: Description of relationship(s) between the subject organism and other organism(s) it is associated with. E.g., parasite on species X; mutualist with species Y. The target organism is the subject of the relationship, and the other organism(s) is the object
  • Range: biotic_relationship_enum
  • Example: free living None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞specific_host _0..1
  • Description: Report the host's taxonomic name and/or NCBI taxonomy ID.
  • Range: String
  • Example: Homo sapiens and/or 9606 None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞host_spec_range _0..1
  • Description: The range and diversity of host species that an organism is capable of infecting, defined by NCBI taxonomy identifier.
  • Range: Integer
  • Example: 9606 None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞health_disease_stat _0..1
  • Description: Health or disease status of specific host at time of collection
  • Range: health_disease_stat_enum
  • Example: dead None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞host_disease_stat _0..1
  • Description: List of diseases with which the host has been diagnosed; can include multiple diagnoses. The value of the field depends on host; for humans the terms should be chosen from the DO (Human Disease Ontology) at https://www.disease-ontology.org, non-human host diseases are free text
  • Range: String
  • Example: rabies [DOID:11260] None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞trophic_level _0..1
  • Description: Trophic levels are the feeding position in a food chain. Microbes can be a range of producers (e.g. chemolithotroph)
  • Range: trophic_level_enum
  • Example: heterotroph None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞propagation _0..1
  • Description: The type of reproduction from the parent stock. Values for this field is specific to different taxa. For phage or virus: lytic/lysogenic/temperate/obligately lytic. For plasmids: incompatibility group. For eukaryotes: sexual/asexual.
  • Range: String
  • Example: lytic None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞isol_growth_condt _1..1
  • Description: Publication reference in the form of pubmed ID (pmid), digital object identifier (doi) or url for isolation and growth condition specifications of the organism/material
  • Range: String
  • Example: doi: 10.1016/j.syapm.2018.01.009 None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞samp_collec_device _0..1
  • Description: The device used to collect an environmental sample. This field accepts terms listed under environmental sampling device (http://purl.obolibrary.org/obo/ENVO). This field also accepts terms listed under specimen collection device (http://purl.obolibrary.org/obo/GENEPIO_0002094).
  • Range: String
  • Example: swab, biopsy, niskin bottle, push core, drag swab [GENEPIO:0002713] None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞samp_collec_method _0..1
  • Description: The method employed for collecting the sample.
  • Range: String
  • Example: swabbing None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞samp_mat_process _0..1
  • Description: A brief description of any processing applied to the sample during or after retrieving the sample from environment, or a link to the relevant protocol(s) performed.
  • Range: String
  • Example: filtering of seawater, storing samples in ethanol None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞samp_size _0..1
  • Description: The total amount or size (volume (ml), mass (g) or area (m2) ) of sample collected.
  • Range: QuantityValue
  • Example: 5 liter None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞nucl_acid_ext _0..1
  • Description: A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample
  • Range: String
  • Example: https://mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞nucl_acid_amp _0..1
  • Description: A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the enzymatic amplification (PCR, TMA, NASBA) of specific nucleic acids
  • Range: String
  • Example: https://phylogenomics.me/protocols/16s-pcr-protocol/ None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞lib_size _0..1
  • Description: Total number of clones in the library prepared for the project
  • Range: Integer
  • Example: 50 None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞lib_reads_seqd _0..1
  • Description: Total number of clones sequenced from the library
  • Range: Integer
  • Example: 20 None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞lib_layout _0..1
  • Description: Specify whether to expect single, paired, or other configuration of reads
  • Range: lib_layout_enum
  • Example: paired None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞lib_vector _0..1
  • Description: Cloning vector type(s) used in construction of libraries
  • Range: String
  • Example: Bacteriophage P1 None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞lib_screen _0..1
  • Description: Specific enrichment or screening methods applied before and/or after creating libraries
  • Range: String
  • Example: enriched, screened, normalized None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞adapters _0..1
  • Description: Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters
  • Range: String
  • Example: AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞seq_meth _1..1
  • Description: Sequencing machine used. Where possible the term should be taken from the OBI list of DNA sequencers (http://purl.obolibrary.org/obo/OBI_0400103).
  • Range: String
  • Example: 454 Genome Sequencer FLX [OBI:0000702] None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞tax_ident _0..1
  • Description: The phylogenetic marker(s) used to assign an organism name to the SAG or MAG
  • Range: tax_ident_enum
  • Example: other: rpoB gene None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞assembly_qual _1..1
  • Description: The assembly quality category is based on sets of criteria outlined for each assembly quality category. For MISAG/MIMAG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities with a consensus error rate equivalent to Q50 or better. High Quality Draft:Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs. Medium Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Low Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to total assembly size, number of contigs, contig N50/L50, and maximum contig length. For MIUVIG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities, with extensive manual review and editing to annotate putative gene functions and transcriptional units. High-quality draft genome: One or multiple fragments, totaling ≥ 90% of the expected genome or replicon sequence or predicted complete. Genome fragment(s): One or multiple fragments, totalling < 90% of the expected genome or replicon sequence, or for which no genome size could be estimated
  • Range: assembly_qual_enum
  • Example: High-quality draft genome None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞assembly_name _0..1
  • Description: Name/version of the assembly provided by the submitter that is used in the genome browsers and in the community
  • Range: String
  • Example: HuRef, JCVI_ISG_i3_1.0 None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞assembly_software _1..1
  • Description: Tool(s) used for assembly, including version number and parameters
  • Range: String
  • Example: metaSPAdes;3.11.0;kmer set 21,33,55,77,99,121, default parameters otherwise None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞annot _0..1
  • Description: Tool used for annotation, or for cases where annotation was provided by a community jamboree or model organism database rather than by a specific submitter
  • Range: String
  • Example: prokka None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞number_contig _1..1
  • Description: Total number of contigs in the cleaned/submitted assembly that makes up a given genome, SAG, MAG, or UViG
  • Range: Integer
  • Example: 40 None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞feat_pred _0..1
  • Description: Method used to predict UViGs features such as ORFs, integration site, etc.
  • Range: String
  • Example: Prodigal;2.6.3;default parameters None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞ref_db _0..1
  • Description: List of database(s) used for ORF annotation, along with version number and reference to website or publication
  • Range: String
  • Example: pVOGs;5;http://dmk-brain.ecn.uiowa.edu/pVOGs/ Grazziotin et al. 2017 doi:10.1093/nar/gkw975 None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞sim_search_meth _0..1
  • Description: Tool used to compare ORFs with database, along with version and cutoffs used
  • Range: String
  • Example: HMMER3;3.1b2;hmmsearch, cutoff of 50 on score None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞tax_class _0..1
  • Description: Method used for taxonomic classification, along with reference database used, classification rank, and thresholds used to classify new genomes
  • Range: String
  • Example: vConTACT vContact2 (references from NCBI RefSeq v83, genus rank classification, default parameters) None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞compl_score _0..1
  • Description: Completeness score is typically based on either the fraction of markers found as compared to a database or the percent of a genome found as compared to a closely related reference genome. High Quality Draft: >90%, Medium Quality Draft: >50%, and Low Quality Draft: < 50% should have the indicated completeness scores
  • Range: compl_score_enum
  • Example: med;60% None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞compl_software _0..1
  • Description: Tools used for completion estimate, i.e. checkm, anvi'o, busco
  • Range: String
  • Example: checkm None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞associated resource _0..1
  • Description: A related resource that is referenced, cited, or otherwise associated to the sequence.
  • Range: String
  • Example: http://www.earthmicrobiome.org/ None

Mixed in from MIGS eukaryote:

• MIGS eukaryote➞sop _0..1
  • Description: Standard operating procedures used in assembly and/or annotation of genomes, metagenomes or environmental sequences
  • Range: String
  • Example: http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/ None