Class: sediment MIMAG

Combinatorial checklist Minimum Information About a Metagenome-Assembled Genome with environmental package sediment

URI: mixs.vocab:SedimentMIMAG

Parents

• is_a: Sediment - sediment

Uses Mixin

• mixin: MIMAG - Minimum Information About a Metagenome-Assembled Genome

Attributes

Inherited from sediment:

• lat_lon _0..1
  • Description: The geographical origin of the sample as defined by latitude and longitude. The values should be reported in decimal degrees and in WGS84 system
  • Range: String
  • Example: 50.586825 6.408977 None
• sediment➞depth _1..1
  • Description: The vertical distance below local surface, e.g. for sediment or soil samples depth is measured from sediment or soil surface, respectively. Depth can be reported as an interval for subsurface samples.
  • Range: QuantityValue
  • Example: 10 meter None
• alt _0..1
  • Description: Altitude is a term used to identify heights of objects such as airplanes, space shuttles, rockets, atmospheric balloons and heights of places such as atmospheric layers and clouds. It is used to measure the height of an object which is above the earth's surface. In this context, the altitude measurement is the vertical distance between the earth's surface above sea level and the sampled position in the air
  • Range: QuantityValue
  • Example: 100 meter None
• sediment➞elev _0..1
  • Description: Elevation of the sampling site is its height above a fixed reference point, most commonly the mean sea level. Elevation is mainly used when referring to points on the earth's surface, while altitude is used for points above the surface, such as an aircraft in flight or a spacecraft in orbit.
  • Range: QuantityValue
  • Example: 100 meter None
• sediment➞temp _0..1
  • Description: Temperature of the sample at the time of sampling.
  • Range: QuantityValue
  • Example: 25 degree Celsius None
• geo_loc_name _0..1
  • Description: The geographical origin of the sample as defined by the country or sea name followed by specific region name. Country or sea names should be chosen from the INSDC country list (http://insdc.org/country.html), or the GAZ ontology (http://purl.bioontology.org/ontology/GAZ)
  • Range: String
  • Example: USA: Maryland, Bethesda None
• collection_date _0..1
  • Description: The time of sampling, either as an instance (single point in time) or interval. In case no exact time is available, the date/time can be right truncated i.e. all of these are valid times: 2008-01-23T19:23:10+00:00; 2008-01-23T19:23:10; 2008-01-23; 2008-01; 2008; Except: 2008-01; 2008 all are ISO8601 compliant
  • Range: Date
  • Example: 2018-05-11T10:00:00+01:00; 2018-05-11 None
• env_broad_scale _0..1
  • Description: Report the major environmental system the sample or specimen came from. The system(s) identified should have a coarse spatial grain, to provide the general environmental context of where the sampling was done (e.g. in the desert or a rainforest). We recommend using subclasses of EnvO’s biome class: http://purl.obolibrary.org/obo/ENVO_00000428. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS
  • Range: String
  • Example: oceanic epipelagic zone biome [ENVO:01000033] for annotating a water sample from the photic zone in middle of the Atlantic Ocean None
• env_local_scale _0..1
  • Description: Report the entity or entities which are in the sample or specimen’s local vicinity and which you believe have significant causal influences on your sample or specimen. We recommend using EnvO terms which are of smaller spatial grain than your entry for env_broad_scale. Terms, such as anatomical sites, from other OBO Library ontologies which interoperate with EnvO (e.g. UBERON) are accepted in this field. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS.
  • Range: String
  • Example: litter layer [ENVO:01000338]; Annotating a pooled sample taken from various vegetation layers in a forest consider: canopy [ENVO:00000047]|herb and fern layer [ENVO:01000337]|litter layer [ENVO:01000338]|understory [01000335]|shrub layer [ENVO:01000336]. None
• env_medium _0..1
  • Description: Report the environmental material(s) immediately surrounding the sample or specimen at the time of sampling. We recommend using subclasses of 'environmental material' (http://purl.obolibrary.org/obo/ENVO_00010483). EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS . Terms from other OBO ontologies are permissible as long as they reference mass/volume nouns (e.g. air, water, blood) and not discrete, countable entities (e.g. a tree, a leaf, a table top).
  • Range: String
  • Example: soil [ENVO:00001998]; Annotating a fish swimming in the upper 100 m of the Atlantic Ocean, consider: ocean water [ENVO:00002151]. Example: Annotating a duck on a pond consider: pond water [ENVO:00002228]|air [ENVO_00002005] None
• sediment➞alkalinity _0..1
  • Description: Alkalinity, the ability of a solution to neutralize acids to the equivalence point of carbonate or bicarbonate
  • Range: QuantityValue
  • Example: 50 milligram per liter None
• sediment➞alkyl_diethers _0..1
  • Description: Concentration of alkyl diethers
  • Range: QuantityValue
  • Example: 0.005 mole per liter None
• sediment➞aminopept_act _0..1
  • Description: Measurement of aminopeptidase activity
  • Range: QuantityValue
  • Example: 0.269 mole per liter per hour None
• sediment➞ammonium _0..1
  • Description: Concentration of ammonium in the sample
  • Range: QuantityValue
  • Example: 1.5 milligram per liter None
• sediment➞bacteria_carb_prod _0..1
  • Description: Measurement of bacterial carbon production
  • Range: QuantityValue
  • Example: 2.53 microgram per liter per hour None
• sediment➞biomass _0..*
  • Description: Amount of biomass; should include the name for the part of biomass measured, e.g. Microbial, total. Can include multiple measurements
  • Range: String
  • Example: total;20 gram None
• sediment➞bishomohopanol _0..1
  • Description: Concentration of bishomohopanol
  • Range: QuantityValue
  • Example: 14 microgram per liter None
• sediment➞bromide _0..1
  • Description: Concentration of bromide
  • Range: QuantityValue
  • Example: 0.05 parts per million None
• sediment➞calcium _0..1
  • Description: Concentration of calcium in the sample
  • Range: QuantityValue
  • Example: 0.2 micromole per liter None
• sediment➞carb_nitro_ratio _0..1
  • Description: Ratio of amount or concentrations of carbon to nitrogen
  • Range: QuantityValue
  • Example: 0.417361111 None
• sediment➞chem_administration _0..*
  • Description: List of chemical compounds administered to the host or site where sampling occurred, and when (e.g. Antibiotics, n fertilizer, air filter); can include multiple compounds. For chemical entities of biological interest ontology (chebi) (v 163), http://purl.bioontology.org/ontology/chebi
  • Range: String
  • Example: agar [CHEBI:2509];2018-05-11T20:00Z None
• sediment➞chloride _0..1
  • Description: Concentration of chloride in the sample
  • Range: QuantityValue
  • Example: 5000 milligram per liter None
• sediment➞chlorophyll _0..1
  • Description: Concentration of chlorophyll
  • Range: QuantityValue
  • Example: 5 milligram per cubic meter None
• sediment➞density _0..1
  • Description: Density of the sample, which is its mass per unit volume (aka volumetric mass density)
  • Range: QuantityValue
  • Example: 1000 kilogram per cubic meter None
• sediment➞diether_lipids _0..*
  • Description: Concentration of diether lipids; can include multiple types of diether lipids
  • Range: String
  • Example: 0.2 nanogram per liter None
• sediment➞diss_carb_dioxide _0..1
  • Description: Concentration of dissolved carbon dioxide in the sample or liquid portion of the sample
  • Range: QuantityValue
  • Example: 5 milligram per liter None
• sediment➞diss_hydrogen _0..1
  • Description: Concentration of dissolved hydrogen
  • Range: QuantityValue
  • Example: 0.3 micromole per liter None
• sediment➞diss_inorg_carb _0..1
  • Description: Dissolved inorganic carbon concentration in the sample, typically measured after filtering the sample using a 0.45 micrometer filter
  • Range: QuantityValue
  • Example: 2059 micromole per kilogram None
• sediment➞diss_org_carb _0..1
  • Description: Concentration of dissolved organic carbon in the sample, liquid portion of the sample, or aqueous phase of the fluid
  • Range: QuantityValue
  • Example: 197 micromole per liter None
• sediment➞diss_org_nitro _0..1
  • Description: Dissolved organic nitrogen concentration measured as; total dissolved nitrogen - NH4 - NO3 - NO2
  • Range: QuantityValue
  • Example: 0.05 micromole per liter None
• sediment➞diss_oxygen _0..1
  • Description: Concentration of dissolved oxygen
  • Range: QuantityValue
  • Example: 175 micromole per kilogram None
• sediment➞glucosidase_act _0..1
  • Description: Measurement of glucosidase activity
  • Range: QuantityValue
  • Example: 5 mol per liter per hour None
• sediment➞magnesium _0..1
  • Description: Concentration of magnesium in the sample
  • Range: QuantityValue
  • Example: 52.8 micromole per kilogram None
• sediment➞mean_frict_vel _0..1
  • Description: Measurement of mean friction velocity
  • Range: QuantityValue
  • Example: 0.5 meter per second None
• sediment➞mean_peak_frict_vel _0..1
  • Description: Measurement of mean peak friction velocity
  • Range: QuantityValue
  • Example: 1 meter per second None
• sediment➞methane _0..1
  • Description: Methane (gas) amount or concentration at the time of sampling
  • Range: QuantityValue
  • Example: 1800 parts per billion None
• sediment➞misc_param _0..*
  • Description: Any other measurement performed or parameter collected, that is not listed here
  • Range: String
  • Example: Bicarbonate ion concentration;2075 micromole per kilogram None
• sediment➞n_alkanes _0..*
  • Description: Concentration of n-alkanes; can include multiple n-alkanes
  • Range: String
  • Example: n-hexadecane;100 milligram per liter None
• sediment➞nitrate _0..1
  • Description: Concentration of nitrate in the sample
  • Range: QuantityValue
  • Example: 65 micromole per liter None
• sediment➞nitrite _0..1
  • Description: Concentration of nitrite in the sample
  • Range: QuantityValue
  • Example: 0.5 micromole per liter None
• sediment➞nitro _0..1
  • Description: Concentration of nitrogen (total)
  • Range: QuantityValue
  • Example: 4.2 micromole per liter None
• sediment➞org_carb _0..1
  • Description: Concentration of organic carbon
  • Range: QuantityValue
  • Example: 1.5 microgram per liter None
• sediment➞org_matter _0..1
  • Description: Concentration of organic matter
  • Range: QuantityValue
  • Example: 1.75 milligram per cubic meter None
• sediment➞org_nitro _0..1
  • Description: Concentration of organic nitrogen
  • Range: QuantityValue
  • Example: 4 micromole per liter None
• sediment➞organism_count _0..*
  • Description: Total cell count of any organism (or group of organisms) per gram, volume or area of sample, should include name of organism followed by count. The method that was used for the enumeration (e.g. qPCR, atp, mpn, etc.) Should also be provided. (example: total prokaryotes; 3.5e7 cells per ml; qpcr)
  • Range: organism_count_enum
  • Example: total prokaryotes;3.5e7 cells per milliliter;qPCR None
• sediment➞oxy_stat_samp _0..1
  • Description: Oxygenation status of sample
  • Range: oxy_stat_samp_enum
  • Example: aerobic None
• sediment➞ph _0..1
  • Description: Ph measurement of the sample, or liquid portion of sample, or aqueous phase of the fluid
  • Range: Double
  • Example: 7.2 None
• sediment➞particle_class _0..*
  • Description: Particles are classified, based on their size, into six general categories:clay, silt, sand, gravel, cobbles, and boulders; should include amount of particle preceded by the name of the particle type; can include multiple values
  • Range: String
  • Example: None
• sediment➞part_org_carb _0..1
  • Description: Concentration of particulate organic carbon
  • Range: QuantityValue
  • Example: 1.92 micromole per liter None
• sediment➞perturbation _0..*
  • Description: Type of perturbation, e.g. chemical administration, physical disturbance, etc., coupled with perturbation regimen including how many times the perturbation was repeated, how long each perturbation lasted, and the start and end time of the entire perturbation period; can include multiple perturbation types
  • Range: String
  • Example: antibiotic addition;R2/2018-05-11T14:30Z/2018-05-11T19:30Z/P1H30M None
• sediment➞petroleum_hydrocarb _0..1
  • Description: Concentration of petroleum hydrocarbon
  • Range: QuantityValue
  • Example: 0.05 micromole per liter None
• sediment➞phaeopigments _0..*
  • Description: Concentration of phaeopigments; can include multiple phaeopigments
  • Range: String
  • Example: 2.5 milligram per cubic meter None
• sediment➞phosphate _0..1
  • Description: Concentration of phosphate
  • Range: QuantityValue
  • Example: 0.7 micromole per liter None
• sediment➞phosplipid_fatt_acid _0..*
  • Description: Concentration of phospholipid fatty acids; can include multiple values
  • Range: String
  • Example: 2.98 milligram per liter None
• sediment➞porosity _0..1
  • Description: Porosity of deposited sediment is volume of voids divided by the total volume of sample
  • Range: String
  • Example: None
• sediment➞potassium _0..1
  • Description: Concentration of potassium in the sample
  • Range: QuantityValue
  • Example: 463 milligram per liter None
• sediment➞pressure _0..1
  • Description: Pressure to which the sample is subject to, in atmospheres
  • Range: QuantityValue
  • Example: 50 atmosphere None
• sediment➞redox_potential _0..1
  • Description: Redox potential, measured relative to a hydrogen cell, indicating oxidation or reduction potential
  • Range: QuantityValue
  • Example: 300 millivolt None
• sediment➞salinity _0..1
  • Description: The total concentration of all dissolved salts in a liquid or solid sample. While salinity can be measured by a complete chemical analysis, this method is difficult and time consuming. More often, it is instead derived from the conductivity measurement. This is known as practical salinity. These derivations compare the specific conductance of the sample to a salinity standard such as seawater.
  • Range: QuantityValue
  • Example: 25 practical salinity unit None
• sediment➞samp_store_dur _0..1
  • Description: Duration for which the sample was stored
  • Range: String
  • Example: P1Y6M None
• sediment➞samp_store_loc _0..1
  • Description: Location at which sample was stored, usually name of a specific freezer/room
  • Range: String
  • Example: Freezer no:5 None
• sediment➞samp_store_temp _0..1
  • Description: Temperature at which sample was stored, e.g. -80 degree Celsius
  • Range: QuantityValue
  • Example: -80 degree Celsius None
• sediment➞sediment_type _0..1
  • Description: Information about the sediment type based on major constituents
  • Range: sediment_type_enum
  • Example: biogenous None
• sediment➞silicate _0..1
  • Description: Concentration of silicate
  • Range: QuantityValue
  • Example: 0.05 micromole per liter None
• sediment➞sodium _0..1
  • Description: Sodium concentration in the sample
  • Range: QuantityValue
  • Example: 10.5 milligram per liter None
• sediment➞sulfate _0..1
  • Description: Concentration of sulfate in the sample
  • Range: QuantityValue
  • Example: 5 micromole per liter None
• sediment➞sulfide _0..1
  • Description: Concentration of sulfide in the sample
  • Range: QuantityValue
  • Example: 2 micromole per liter None
• sediment➞tidal_stage _0..1
  • Description: Stage of tide
  • Range: tidal_stage_enum
  • Example: high tide None
• sediment➞tot_carb _0..1
  • Description: Total carbon content
  • Range: QuantityValue
  • Example: None
• sediment➞tot_depth_water_col _0..1
  • Description: Measurement of total depth of water column
  • Range: QuantityValue
  • Example: 500 meter None
• sediment➞tot_nitro_content _0..1
  • Description: Total nitrogen content of the sample
  • Range: QuantityValue
  • Example: None
• sediment➞tot_org_carb _0..1
  • Description: Definition for soil: total organic carbon content of the soil, definition otherwise: total organic carbon content
  • Range: QuantityValue
  • Example: None
• sediment➞turbidity _0..1
  • Description: Measure of the amount of cloudiness or haziness in water caused by individual particles
  • Range: QuantityValue
  • Example: 0.3 nephelometric turbidity units None
• sediment➞water_content _0..1
  • Description: Water content measurement
  • Range: QuantityValue
  • Example: None
• sediment➞samp_name _1..1
  • Description: A local identifier or name that for the material sample used for extracting nucleic acids, and subsequent sequencing. It can refer either to the original material collected or to any derived sub-samples. It can have any format, but we suggest that you make it concise, unique and consistent within your lab, and as informative as possible. INSDC requires every sample name from a single Submitter to be unique. Use of a globally unique identifier for the field source_mat_id is recommended in addition to sample_name.
  • Range: String
  • Example: ISDsoil1 None
• sediment➞project_name _1..1
  • Description: Name of the project within which the sequencing was organized
  • Range: String
  • Example: Forest soil metagenome None
• sediment➞samp_vol_we_dna_ext _0..1
  • Description: Volume (ml) or mass (g) of total collected sample processed for DNA extraction. Note: total sample collected should be entered under the term Sample Size (MIXS:0000001).
  • Range: QuantityValue
  • Example: 1500 milliliter None

Mixed in from MIMAG:

• MIMAG➞submitted_to_insdc _1..1
  • Description: Depending on the study (large-scale e.g. done with next generation sequencing technology, or small-scale) sequences have to be submitted to SRA (Sequence Read Archive), DRA (DDBJ Read Archive) or via the classical Webin/Sequin systems to Genbank, ENA and DDBJ. Although this field is mandatory, it is meant as a self-test field, therefore it is not necessary to include this field in contextual data submitted to databases
  • Range: String
  • Example: yes None

Mixed in from MIMAG:

• MIMAG➞investigation_type _1..1
  • Description: Nucleic Acid Sequence Report is the root element of all MIGS/MIMS compliant reports as standardized by Genomic Standards Consortium. This field is either eukaryote,bacteria,virus,plasmid,organelle, metagenome,mimarks-survey, mimarks-specimen, metatranscriptome, single amplified genome, metagenome-assembled genome, or uncultivated viral genome
  • Range: investigation_type_enum
  • Example: metagenome None

Mixed in from MIMAG:

• MIMAG➞samp_taxon_id _1..1
  • Description: NCBI taxon id of the sample. Maybe be a single taxon or mixed taxa sample. Use 'synthetic metagenome’ for mock community/positive controls, or 'blank sample' for negative controls.
  • Range: String
  • Example: Gut Metagenome [NCBI:txid749906] None

Mixed in from MIMAG:

• MIMAG➞experimental_factor _0..1
  • Description: Experimental factors are essentially the variable aspects of an experiment design which can be used to describe an experiment, or set of experiments, in an increasingly detailed manner. This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). For a browser of EFO (v 2.95) terms, please see http://purl.bioontology.org/ontology/EFO; for a browser of OBI (v 2018-02-12) terms please see http://purl.bioontology.org/ontology/OBI
  • Range: String
  • Example: time series design [EFO:EFO_0001779] None

Mixed in from MIMAG:

• MIMAG➞neg_cont_type _0..1
  • Description: The substance or equipment used as a negative control in an investigation
  • Range: neg_cont_type_enum
  • Example: None

Mixed in from MIMAG:

• MIMAG➞pos_cont_type _0..1
  • Description: The substance, mixture, product, or apparatus used to verify that a process which is part of an investigation delivers a true positive.
  • Range: String
  • Example: None

Mixed in from MIMAG:

• MIMAG➞env_package _0..1
  • Description: MIxS extension for reporting of measurements and observations obtained from one or more of the environments where the sample was obtained. All environmental packages listed here are further defined in separate subtables. By giving the name of the environmental package, a selection of fields can be made from the subtables and can be reported
  • Range: env_package_enum
  • Example: soil None

Mixed in from MIMAG:

• MIMAG➞ref_biomaterial _0..1
  • Description: Primary publication if isolated before genome publication; otherwise, primary genome report.
  • Range: String
  • Example: doi:10.1016/j.syapm.2018.01.009 None

Mixed in from MIMAG:

• MIMAG➞source_mat_id _0..1
  • Description: A unique identifier assigned to a material sample (as defined by http://rs.tdwg.org/dwc/terms/materialSampleID, and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing. The identifier can refer either to the original material collected or to any derived sub-samples. The INSDC qualifiers /specimen_voucher, /bio_material, or /culture_collection may or may not share the same value as the source_mat_id field. For instance, the /specimen_voucher qualifier and source_mat_id may both contain 'UAM:Herps:14' , referring to both the specimen voucher and sampled tissue with the same identifier. However, the /culture_collection qualifier may refer to a value from an initial culture (e.g. ATCC:11775) while source_mat_id would refer to an identifier from some derived culture from which the nucleic acids were extracted (e.g. xatc123 or ark:/2154/R2).
  • Range: String
  • Example: MPI012345 None

Mixed in from MIMAG:

• MIMAG➞rel_to_oxygen _0..1
  • Description: Is this organism an aerobe, anaerobe? Please note that aerobic and anaerobic are valid descriptors for microbial environments
  • Range: rel_to_oxygen_enum
  • Example: aerobe None

Mixed in from MIMAG:

• MIMAG➞samp_collec_device _0..1
  • Description: The device used to collect an environmental sample. This field accepts terms listed under environmental sampling device (http://purl.obolibrary.org/obo/ENVO). This field also accepts terms listed under specimen collection device (http://purl.obolibrary.org/obo/GENEPIO_0002094).
  • Range: String
  • Example: swab, biopsy, niskin bottle, push core, drag swab [GENEPIO:0002713] None

Mixed in from MIMAG:

• MIMAG➞samp_collec_method _0..1
  • Description: The method employed for collecting the sample.
  • Range: String
  • Example: swabbing None

Mixed in from MIMAG:

• MIMAG➞samp_mat_process _0..1
  • Description: A brief description of any processing applied to the sample during or after retrieving the sample from environment, or a link to the relevant protocol(s) performed.
  • Range: String
  • Example: filtering of seawater, storing samples in ethanol None

Mixed in from MIMAG:

• MIMAG➞size_frac _0..1
  • Description: Filtering pore size used in sample preparation
  • Range: String
  • Example: 0-0.22 micrometer None

Mixed in from MIMAG:

• MIMAG➞samp_size _0..1
  • Description: The total amount or size (volume (ml), mass (g) or area (m2) ) of sample collected.
  • Range: QuantityValue
  • Example: 5 liter None

Mixed in from MIMAG:

• MIMAG➞nucl_acid_ext _0..1
  • Description: A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample
  • Range: String
  • Example: https://mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf None

Mixed in from MIMAG:

• MIMAG➞nucl_acid_amp _0..1
  • Description: A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the enzymatic amplification (PCR, TMA, NASBA) of specific nucleic acids
  • Range: String
  • Example: https://phylogenomics.me/protocols/16s-pcr-protocol/ None

Mixed in from MIMAG:

• MIMAG➞lib_size _0..1
  • Description: Total number of clones in the library prepared for the project
  • Range: Integer
  • Example: 50 None

Mixed in from MIMAG:

• MIMAG➞lib_reads_seqd _0..1
  • Description: Total number of clones sequenced from the library
  • Range: Integer
  • Example: 20 None

Mixed in from MIMAG:

• MIMAG➞lib_layout _0..1
  • Description: Specify whether to expect single, paired, or other configuration of reads
  • Range: lib_layout_enum
  • Example: paired None

Mixed in from MIMAG:

• MIMAG➞lib_vector _0..1
  • Description: Cloning vector type(s) used in construction of libraries
  • Range: String
  • Example: Bacteriophage P1 None

Mixed in from MIMAG:

• MIMAG➞lib_screen _0..1
  • Description: Specific enrichment or screening methods applied before and/or after creating libraries
  • Range: String
  • Example: enriched, screened, normalized None

Mixed in from MIMAG:

• MIMAG➞mid _0..1
  • Description: Molecular barcodes, called Multiplex Identifiers (MIDs), that are used to specifically tag unique samples in a sequencing run. Sequence should be reported in uppercase letters
  • Range: String
  • Example: GTGAATAT None

Mixed in from MIMAG:

• MIMAG➞adapters _0..1
  • Description: Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters
  • Range: String
  • Example: AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT None

Mixed in from MIMAG:

• MIMAG➞seq_meth _1..1
  • Description: Sequencing machine used. Where possible the term should be taken from the OBI list of DNA sequencers (http://purl.obolibrary.org/obo/OBI_0400103).
  • Range: String
  • Example: 454 Genome Sequencer FLX [OBI:0000702] None

Mixed in from MIMAG:

• MIMAG➞tax_ident _1..1
  • Description: The phylogenetic marker(s) used to assign an organism name to the SAG or MAG
  • Range: tax_ident_enum
  • Example: other: rpoB gene None

Mixed in from MIMAG:

• MIMAG➞assembly_qual _1..1
  • Description: The assembly quality category is based on sets of criteria outlined for each assembly quality category. For MISAG/MIMAG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities with a consensus error rate equivalent to Q50 or better. High Quality Draft:Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs. Medium Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Low Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to total assembly size, number of contigs, contig N50/L50, and maximum contig length. For MIUVIG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities, with extensive manual review and editing to annotate putative gene functions and transcriptional units. High-quality draft genome: One or multiple fragments, totaling ≥ 90% of the expected genome or replicon sequence or predicted complete. Genome fragment(s): One or multiple fragments, totalling < 90% of the expected genome or replicon sequence, or for which no genome size could be estimated
  • Range: assembly_qual_enum
  • Example: High-quality draft genome None

Mixed in from MIMAG:

• MIMAG➞assembly_name _0..1
  • Description: Name/version of the assembly provided by the submitter that is used in the genome browsers and in the community
  • Range: String
  • Example: HuRef, JCVI_ISG_i3_1.0 None

Mixed in from MIMAG:

• MIMAG➞assembly_software _1..1
  • Description: Tool(s) used for assembly, including version number and parameters
  • Range: String
  • Example: metaSPAdes;3.11.0;kmer set 21,33,55,77,99,121, default parameters otherwise None

Mixed in from MIMAG:

• MIMAG➞annot _0..1
  • Description: Tool used for annotation, or for cases where annotation was provided by a community jamboree or model organism database rather than by a specific submitter
  • Range: String
  • Example: prokka None

Mixed in from MIMAG:

• MIMAG➞number_contig _0..1
  • Description: Total number of contigs in the cleaned/submitted assembly that makes up a given genome, SAG, MAG, or UViG
  • Range: Integer
  • Example: 40 None

Mixed in from MIMAG:

• MIMAG➞feat_pred _0..1
  • Description: Method used to predict UViGs features such as ORFs, integration site, etc.
  • Range: String
  • Example: Prodigal;2.6.3;default parameters None

Mixed in from MIMAG:

• MIMAG➞ref_db _0..1
  • Description: List of database(s) used for ORF annotation, along with version number and reference to website or publication
  • Range: String
  • Example: pVOGs;5;http://dmk-brain.ecn.uiowa.edu/pVOGs/ Grazziotin et al. 2017 doi:10.1093/nar/gkw975 None

Mixed in from MIMAG:

• MIMAG➞sim_search_meth _0..1
  • Description: Tool used to compare ORFs with database, along with version and cutoffs used
  • Range: String
  • Example: HMMER3;3.1b2;hmmsearch, cutoff of 50 on score None

Mixed in from MIMAG:

• MIMAG➞tax_class _0..1
  • Description: Method used for taxonomic classification, along with reference database used, classification rank, and thresholds used to classify new genomes
  • Range: String
  • Example: vConTACT vContact2 (references from NCBI RefSeq v83, genus rank classification, default parameters) None

Mixed in from MIMAG:

• MIMAG➞x_16s_recover _0..1
  • Description: Can a 16S gene be recovered from the submitted SAG or MAG?
  • Range: String
  • Example: yes None

Mixed in from MIMAG:

• MIMAG➞x_16s_recover_software _0..1
  • Description: Tools used for 16S rRNA gene extraction
  • Range: String
  • Example: rambl;v2;default parameters None

Mixed in from MIMAG:

• MIMAG➞trnas _0..1
  • Description: The total number of tRNAs identified from the SAG or MAG
  • Range: Integer
  • Example: 18 None

Mixed in from MIMAG:

• MIMAG➞trna_ext_software _0..1
  • Description: Tools used for tRNA identification
  • Range: String
  • Example: infernal;v2;default parameters None

Mixed in from MIMAG:

• MIMAG➞compl_score _1..1
  • Description: Completeness score is typically based on either the fraction of markers found as compared to a database or the percent of a genome found as compared to a closely related reference genome. High Quality Draft: >90%, Medium Quality Draft: >50%, and Low Quality Draft: < 50% should have the indicated completeness scores
  • Range: compl_score_enum
  • Example: med;60% None

Mixed in from MIMAG:

• MIMAG➞compl_software _1..1
  • Description: Tools used for completion estimate, i.e. checkm, anvi'o, busco
  • Range: String
  • Example: checkm None

Mixed in from MIMAG:

• MIMAG➞compl_appr _0..1
  • Description: The approach used to determine the completeness of a given genomic assembly, which would typically make use of a set of conserved marker genes or a closely related reference genome. For UViG completeness, include reference genome or group used, and contig feature suggesting a complete genome
  • Range: compl_appr_enum
  • Example: other: UViG length compared to the average length of reference genomes from the P22virus genus (NCBI RefSeq v83) None

Mixed in from MIMAG:

• MIMAG➞contam_score _1..1
  • Description: The contamination score is based on the fraction of single-copy genes that are observed more than once in a query genome. The following scores are acceptable for; High Quality Draft: < 5%, Medium Quality Draft: < 10%, Low Quality Draft: < 10%. Contamination must be below 5% for a SAG or MAG to be deposited into any of the public databases
  • Range: String
  • Example: 1% None

Mixed in from MIMAG:

• MIMAG➞contam_screen_input _0..1
  • Description: The type of sequence data used as input
  • Range: String
  • Example: contigs None

Mixed in from MIMAG:

• MIMAG➞contam_screen_param _0..1
  • Description: Specific parameters used in the decontamination sofware, such as reference database, coverage, and kmers. Combinations of these parameters may also be used, i.e. kmer and coverage, or reference database and kmer
  • Range: contam_screen_param_enum
  • Example: kmer None

Mixed in from MIMAG:

• MIMAG➞decontam_software _0..1
  • Description: Tool(s) used in contamination screening
  • Range: decontam_software_enum
  • Example: anvi'o None

Mixed in from MIMAG:

• MIMAG➞bin_param _1..1
  • Description: The parameters that have been applied during the extraction of genomes from metagenomic datasets
  • Range: bin_param_enum
  • Example: coverage and kmer None

Mixed in from MIMAG:

• MIMAG➞bin_software _1..1
  • Description: Tool(s) used for the extraction of genomes from metagenomic datasets, where possible include a product ID (PID) of the tool(s) used.
  • Range: String
  • Example: MetaCluster-TA (RRID:SCR_004599), MaxBin (biotools:maxbin) None

Mixed in from MIMAG:

• MIMAG➞reassembly_bin _0..1
  • Description: Has an assembly been performed on a genome bin extracted from a metagenomic assembly?
  • Range: String
  • Example: no None

Mixed in from MIMAG:

• MIMAG➞mag_cov_software _0..1
  • Description: Tool(s) used to determine the genome coverage if coverage is used as a binning parameter in the extraction of genomes from metagenomic datasets
  • Range: mag_cov_software_enum
  • Example: bbmap None

Mixed in from MIMAG:

• MIMAG➞associated resource _0..1
  • Description: A related resource that is referenced, cited, or otherwise associated to the sequence.
  • Range: String
  • Example: http://www.earthmicrobiome.org/ None

Mixed in from MIMAG:

• MIMAG➞sop _0..1
  • Description: Standard operating procedures used in assembly and/or annotation of genomes, metagenomes or environmental sequences
  • Range: String
  • Example: http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/ None