Class: hydrocarbon resources-fluids_swabs MIGS org

Combinatorial checklist Minimal Information about a Genome Sequence: org with environmental package hydrocarbon resources-fluids_swabs

URI: mixs.vocab:HydrocarbonResources-fluidsSwabsMIGSOrg

Parents

• is_a: HydrocarbonResources-fluidsSwabs - hydrocarbon resources-fluids/swabs

Uses Mixin

• mixin: MIGSOrg - Minimal Information about a Genome Sequence: org

Attributes

Inherited from hydrocarbon resources-fluids_swabs:

• lat_lon _0..1
  • Description: The geographical origin of the sample as defined by latitude and longitude. The values should be reported in decimal degrees and in WGS84 system
  • Range: String
  • Example: 50.586825 6.408977 None
• depth _0..1
  • Description: The vertical distance below local surface, e.g. for sediment or soil samples depth is measured from sediment or soil surface, respectively. Depth can be reported as an interval for subsurface samples.
  • Range: QuantityValue
  • Example: 10 meter None
• alt _0..1
  • Description: Altitude is a term used to identify heights of objects such as airplanes, space shuttles, rockets, atmospheric balloons and heights of places such as atmospheric layers and clouds. It is used to measure the height of an object which is above the earth's surface. In this context, the altitude measurement is the vertical distance between the earth's surface above sea level and the sampled position in the air
  • Range: QuantityValue
  • Example: 100 meter None
• elev _0..1
  • Description: Elevation of the sampling site is its height above a fixed reference point, most commonly the mean sea level. Elevation is mainly used when referring to points on the earth's surface, while altitude is used for points above the surface, such as an aircraft in flight or a spacecraft in orbit.
  • Range: QuantityValue
  • Example: 100 meter None
• hydrocarbon resources-fluids_swabs➞temp _1..1
  • Description: Temperature of the sample at the time of sampling.
  • Range: QuantityValue
  • Example: 25 degree Celsius None
• geo_loc_name _0..1
  • Description: The geographical origin of the sample as defined by the country or sea name followed by specific region name. Country or sea names should be chosen from the INSDC country list (http://insdc.org/country.html), or the GAZ ontology (http://purl.bioontology.org/ontology/GAZ)
  • Range: String
  • Example: USA: Maryland, Bethesda None
• collection_date _0..1
  • Description: The time of sampling, either as an instance (single point in time) or interval. In case no exact time is available, the date/time can be right truncated i.e. all of these are valid times: 2008-01-23T19:23:10+00:00; 2008-01-23T19:23:10; 2008-01-23; 2008-01; 2008; Except: 2008-01; 2008 all are ISO8601 compliant
  • Range: Date
  • Example: 2018-05-11T10:00:00+01:00; 2018-05-11 None
• env_broad_scale _0..1
  • Description: Report the major environmental system the sample or specimen came from. The system(s) identified should have a coarse spatial grain, to provide the general environmental context of where the sampling was done (e.g. in the desert or a rainforest). We recommend using subclasses of EnvO’s biome class: http://purl.obolibrary.org/obo/ENVO_00000428. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS
  • Range: String
  • Example: oceanic epipelagic zone biome [ENVO:01000033] for annotating a water sample from the photic zone in middle of the Atlantic Ocean None
• env_local_scale _0..1
  • Description: Report the entity or entities which are in the sample or specimen’s local vicinity and which you believe have significant causal influences on your sample or specimen. We recommend using EnvO terms which are of smaller spatial grain than your entry for env_broad_scale. Terms, such as anatomical sites, from other OBO Library ontologies which interoperate with EnvO (e.g. UBERON) are accepted in this field. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS.
  • Range: String
  • Example: litter layer [ENVO:01000338]; Annotating a pooled sample taken from various vegetation layers in a forest consider: canopy [ENVO:00000047]|herb and fern layer [ENVO:01000337]|litter layer [ENVO:01000338]|understory [01000335]|shrub layer [ENVO:01000336]. None
• env_medium _0..1
  • Description: Report the environmental material(s) immediately surrounding the sample or specimen at the time of sampling. We recommend using subclasses of 'environmental material' (http://purl.obolibrary.org/obo/ENVO_00010483). EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS . Terms from other OBO ontologies are permissible as long as they reference mass/volume nouns (e.g. air, water, blood) and not discrete, countable entities (e.g. a tree, a leaf, a table top).
  • Range: String
  • Example: soil [ENVO:00001998]; Annotating a fish swimming in the upper 100 m of the Atlantic Ocean, consider: ocean water [ENVO:00002151]. Example: Annotating a duck on a pond consider: pond water [ENVO:00002228]|air [ENVO_00002005] None
• hydrocarbon resources-fluids_swabs➞hcr _1..1
  • Description: Main Hydrocarbon Resource type. The term "Hydrocarbon Resource" HCR defined as a natural environmental feature containing large amounts of hydrocarbons at high concentrations potentially suitable for commercial exploitation. This term should not be confused with the Hydrocarbon Occurrence term which also includes hydrocarbon-rich environments with currently limited commercial interest such as seeps, outcrops, gas hydrates etc. If "other" is specified, please propose entry in "additional info" field
  • Range: hcr_enum
  • Example: Oil Sand None
• hydrocarbon resources-fluids_swabs➞hc_produced _1..1
  • Description: Main hydrocarbon type produced from resource (i.e. Oil, gas, condensate, etc). If "other" is specified, please propose entry in "additional info" field
  • Range: hc_produced_enum
  • Example: Gas None
• hydrocarbon resources-fluids_swabs➞basin _1..1
  • Description: Name of the basin (e.g. Campos)
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞field _0..1
  • Description: Name of the hydrocarbon field (e.g. Albacora)
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞reservoir _0..1
  • Description: Name of the reservoir (e.g. Carapebus)
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞hcr_temp _0..1
  • Description: Original temperature of the hydrocarbon resource
  • Range: String
  • Example: 150-295 degree Celsius None
• hydrocarbon resources-fluids_swabs➞tvdss_of_hcr_temp _0..1
  • Description: True vertical depth subsea (TVDSS) of the hydrocarbon resource where the original temperature was measured (e.g. 1345 m).
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞hcr_pressure _0..1
  • Description: Original pressure of the hydrocarbon resource
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞tvdss_of_hcr_press _0..1
  • Description: True vertical depth subsea (TVDSS) of the hydrocarbon resource where the original pressure was measured (e.g. 1578 m).
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞lithology _0..1
  • Description: Hydrocarbon resource main lithology (Additional information: http://petrowiki.org/Lithology_and_rock_type_determination). If "other" is specified, please propose entry in "additional info" field
  • Range: lithology_enum
  • Example: Volcanic None
• hydrocarbon resources-fluids_swabs➞depos_env _0..1
  • Description: Main depositional environment (https://en.wikipedia.org/wiki/Depositional_environment). If "other" is specified, please propose entry in "additional info" field
  • Range: depos_env_enum
  • Example: Continental - Alluvial None
• hydrocarbon resources-fluids_swabs➞hcr_geol_age _0..1
  • Description: Geological age of hydrocarbon resource (Additional info: https://en.wikipedia.org/wiki/Period_(geology)). If "other" is specified, please propose entry in "additional info" field
  • Range: hcr_geol_age_enum
  • Example: Silurian None
• hydrocarbon resources-fluids_swabs➞hcr_fw_salinity _0..1
  • Description: Original formation water salinity (prior to secondary recovery e.g. Waterflooding) expressed as TDS
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞sulfate_fw _0..1
  • Description: Original sulfate concentration in the hydrocarbon resource
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞vfa_fw _0..1
  • Description: Original volatile fatty acid concentration in the hydrocarbon resource
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞prod_start_date _0..1
  • Description: Date of field's first production
  • Range: Date
  • Example: 2018-05-11 None
• hydrocarbon resources-fluids_swabs➞prod_rate _0..1
  • Description: Oil and/or gas production rates per well (e.g. 524 m3 / day)
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞water_prod_rate _0..1
  • Description: Water production rates per well (e.g. 987 m3 / day)
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞water_cut _1..1
  • Description: Current amount of water (%) in a produced fluid stream; or the average of the combined streams
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞iwf _1..1
  • Description: Proportion of the produced fluids derived from injected water at the time of sampling. (e.g. 87%)
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞add_recov_method _1..1
  • Description: Additional (i.e. Secondary, tertiary, etc.) recovery methods deployed for increase of hydrocarbon recovery from resource and start date for each one of them. If "other" is specified, please propose entry in "additional info" field
  • Range: add_recov_method_enum
  • Example: Polymer Addition;2018-06-21T14:30Z None
• hydrocarbon resources-fluids_swabs➞iw_bt_date_well _0..1
  • Description: Injection water breakthrough date per well following a secondary and/or tertiary recovery
  • Range: Date
  • Example: 2018-05-11 None
• hydrocarbon resources-fluids_swabs➞biocide _0..1
  • Description: List of biocides (commercial name of product and supplier) and date of administration
  • Range: String
  • Example: ALPHA 1427;Baker Hughes;2008-01-23 None
• hydrocarbon resources-fluids_swabs➞biocide_admin_method _0..1
  • Description: Method of biocide administration (dose, frequency, duration, time elapsed between last biociding and sampling) (e.g. 150 mg/l; weekly; 4 hr; 3 days)
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞chem_treatment _0..1
  • Description: List of chemical compounds administered upstream the sampling location where sampling occurred (e.g. Glycols, H2S scavenger, corrosion and scale inhibitors, demulsifiers, and other production chemicals etc.). The commercial name of the product and name of the supplier should be provided. The date of administration should also be included
  • Range: String
  • Example: ACCENT 1125;DOW;2010-11-17 None
• hydrocarbon resources-fluids_swabs➞chem_treat_method _0..1
  • Description: Method of chemical administration(dose, frequency, duration, time elapsed between administration and sampling) (e.g. 50 mg/l; twice a week; 1 hr; 0 days)
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞samp_loc_corr_rate _0..1
  • Description: Metal corrosion rate is the speed of metal deterioration due to environmental conditions. As environmental conditions change corrosion rates change accordingly. Therefore, long term corrosion rates are generally more informative than short term rates and for that reason they are preferred during reporting. In the case of suspected MIC, corrosion rate measurements at the time of sampling might provide insights into the involvement of certain microbial community members in MIC as well as potential microbial interplays
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞samp_well_name _0..1
  • Description: Name of the well (e.g. BXA1123) where sample was taken
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞win _0..1
  • Description: A unique identifier of a well or wellbore. This is part of the Global Framework for Well Identification initiative which is compiled by the Professional Petroleum Data Management Association (PPDM) in an effort to improve well identification systems. (Supporting information: https://ppdm.org/ and http://dl.ppdm.org/dl/690)
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞samp_type _1..1
  • Description: The type of material from which the sample was obtained. For the Hydrocarbon package, samples include types like core, rock trimmings, drill cuttings, piping section, coupon, pigging debris, solid deposit, produced fluid, produced water, injected water, swabs, etc. For the Food Package, samples are usually categorized as food, body products or tissues, or environmental material. This field accepts terms listed under environmental specimen (http://purl.obolibrary.org/obo/GENEPIO_0001246).
  • Range: String
  • Example: built environment sample [GENEPIO:0001248] None
• hydrocarbon resources-fluids_swabs➞samp_subtype _0..1
  • Description: Name of sample sub-type. For example if "sample type" is "Produced Water" then subtype could be "Oil Phase" or "Water Phase". If "other" is specified, please propose entry in "additional info" field
  • Range: samp_subtype_enum
  • Example: biofilm None
• hydrocarbon resources-fluids_swabs➞samp_collect_point _1..1
  • Description: Sampling point on the asset were sample was collected (e.g. Wellhead, storage tank, separator, etc). If "other" is specified, please propose entry in "additional info" field
  • Range: samp_collect_point_enum
  • Example: well None
• hydrocarbon resources-fluids_swabs➞pressure _0..1
  • Description: Pressure to which the sample is subject to, in atmospheres
  • Range: QuantityValue
  • Example: 50 atmosphere None
• hydrocarbon resources-fluids_swabs➞oxy_stat_samp _0..1
  • Description: Oxygenation status of sample
  • Range: oxy_stat_samp_enum
  • Example: aerobic None
• hydrocarbon resources-fluids_swabs➞samp_preserv _0..1
  • Description: Preservative added to the sample (e.g. Rnalater, alcohol, formaldehyde, etc.). Where appropriate include volume added (e.g. Rnalater; 2 ml)
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞samp_transport_cond _0..1
  • Description: Sample transport duration (in days or hrs) and temperature the sample was exposed to (e.g. 5.5 days; 20 ¬∞C)
  • Range: String
  • Example: 5 days;-20 degree Celsius None
• hydrocarbon resources-fluids_swabs➞samp_store_temp _0..1
  • Description: Temperature at which sample was stored, e.g. -80 degree Celsius
  • Range: QuantityValue
  • Example: -80 degree Celsius None
• hydrocarbon resources-fluids_swabs➞samp_store_dur _0..1
  • Description: Duration for which the sample was stored
  • Range: String
  • Example: P1Y6M None
• hydrocarbon resources-fluids_swabs➞samp_store_loc _0..1
  • Description: Location at which sample was stored, usually name of a specific freezer/room
  • Range: String
  • Example: Freezer no:5 None
• hydrocarbon resources-fluids_swabs➞organism_count _0..*
  • Description: Total cell count of any organism (or group of organisms) per gram, volume or area of sample, should include name of organism followed by count. The method that was used for the enumeration (e.g. qPCR, atp, mpn, etc.) Should also be provided. (example: total prokaryotes; 3.5e7 cells per ml; qpcr)
  • Range: organism_count_enum
  • Example: total prokaryotes;3.5e7 cells per milliliter;qPCR None
• hydrocarbon resources-fluids_swabs➞org_count_qpcr_info _0..1
  • Description: If qpcr was used for the cell count, the target gene name, the primer sequence and the cycling conditions should also be provided. (Example: 16S rrna; FWD:ACGTAGCTATGACGT REV:GTGCTAGTCGAGTAC; initial denaturation:90C_5min; denaturation:90C_2min; annealing:52C_30 sec; elongation:72C_30 sec; 90 C for 1 min; final elongation:72C_5min; 30 cycles)
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞ph _0..1
  • Description: Ph measurement of the sample, or liquid portion of sample, or aqueous phase of the fluid
  • Range: Double
  • Example: 7.2 None
• hydrocarbon resources-fluids_swabs➞samp_salinity _1..1
  • Description: Salinity is the total concentration of all dissolved salts in a liquid or solid (in the form of an extract obtained by centrifugation) sample. While salinity can be measured by a complete chemical analysis, this method is difficult and time consuming. More often, it is instead derived from the conductivity measurement. This is known as practical salinity. These derivations compare the specific conductance of the sample to a salinity standard such as seawater
  • Range: QuantityValue
  • Example: 1 milligram per liter None
• hydrocarbon resources-fluids_swabs➞salinity _0..1
  • Description: The total concentration of all dissolved salts in a liquid or solid sample. While salinity can be measured by a complete chemical analysis, this method is difficult and time consuming. More often, it is instead derived from the conductivity measurement. This is known as practical salinity. These derivations compare the specific conductance of the sample to a salinity standard such as seawater.
  • Range: QuantityValue
  • Example: 25 practical salinity unit None
• hydrocarbon resources-fluids_swabs➞alkalinity _0..1
  • Description: Alkalinity, the ability of a solution to neutralize acids to the equivalence point of carbonate or bicarbonate
  • Range: QuantityValue
  • Example: 50 milligram per liter None
• hydrocarbon resources-fluids_swabs➞alkalinity_method _0..1
  • Description: Method used for alkalinity measurement
  • Range: String
  • Example: titration None
• hydrocarbon resources-fluids_swabs➞sulfate _1..1
  • Description: Concentration of sulfate in the sample
  • Range: QuantityValue
  • Example: 5 micromole per liter None
• hydrocarbon resources-fluids_swabs➞sulfide _1..1
  • Description: Concentration of sulfide in the sample
  • Range: QuantityValue
  • Example: 2 micromole per liter None
• hydrocarbon resources-fluids_swabs➞tot_sulfur _0..1
  • Description: Concentration of total sulfur in the sample
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞nitrate _1..1
  • Description: Concentration of nitrate in the sample
  • Range: QuantityValue
  • Example: 65 micromole per liter None
• hydrocarbon resources-fluids_swabs➞nitrite _0..1
  • Description: Concentration of nitrite in the sample
  • Range: QuantityValue
  • Example: 0.5 micromole per liter None
• hydrocarbon resources-fluids_swabs➞ammonium _0..1
  • Description: Concentration of ammonium in the sample
  • Range: QuantityValue
  • Example: 1.5 milligram per liter None
• hydrocarbon resources-fluids_swabs➞tot_nitro _0..1
  • Description: Total nitrogen concentration of water samples, calculated by: total nitrogen = total dissolved nitrogen + particulate nitrogen. Can also be measured without filtering, reported as nitrogen
  • Range: QuantityValue
  • Example: 50 micromole per liter None
• hydrocarbon resources-fluids_swabs➞diss_iron _0..1
  • Description: Concentration of dissolved iron in the sample
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞sodium _0..1
  • Description: Sodium concentration in the sample
  • Range: QuantityValue
  • Example: 10.5 milligram per liter None
• hydrocarbon resources-fluids_swabs➞chloride _0..1
  • Description: Concentration of chloride in the sample
  • Range: QuantityValue
  • Example: 5000 milligram per liter None
• hydrocarbon resources-fluids_swabs➞potassium _0..1
  • Description: Concentration of potassium in the sample
  • Range: QuantityValue
  • Example: 463 milligram per liter None
• hydrocarbon resources-fluids_swabs➞magnesium _0..1
  • Description: Concentration of magnesium in the sample
  • Range: QuantityValue
  • Example: 52.8 micromole per kilogram None
• hydrocarbon resources-fluids_swabs➞calcium _0..1
  • Description: Concentration of calcium in the sample
  • Range: QuantityValue
  • Example: 0.2 micromole per liter None
• hydrocarbon resources-fluids_swabs➞tot_iron _0..1
  • Description: Concentration of total iron in the sample
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞diss_org_carb _0..1
  • Description: Concentration of dissolved organic carbon in the sample, liquid portion of the sample, or aqueous phase of the fluid
  • Range: QuantityValue
  • Example: 197 micromole per liter None
• hydrocarbon resources-fluids_swabs➞diss_inorg_carb _0..1
  • Description: Dissolved inorganic carbon concentration in the sample, typically measured after filtering the sample using a 0.45 micrometer filter
  • Range: QuantityValue
  • Example: 2059 micromole per kilogram None
• hydrocarbon resources-fluids_swabs➞diss_inorg_phosp _0..1
  • Description: Concentration of dissolved inorganic phosphorus in the sample
  • Range: QuantityValue
  • Example: 56.5 micromole per liter None
• hydrocarbon resources-fluids_swabs➞tot_phosp _0..1
  • Description: Total phosphorus concentration in the sample, calculated by: total phosphorus = total dissolved phosphorus + particulate phosphorus
  • Range: QuantityValue
  • Example: 0.03 milligram per liter None
• hydrocarbon resources-fluids_swabs➞suspend_solids _0..*
  • Description: Concentration of substances including a wide variety of material, such as silt, decaying plant and animal matter; can include multiple substances
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞density _0..1
  • Description: Density of the sample, which is its mass per unit volume (aka volumetric mass density)
  • Range: QuantityValue
  • Example: 1000 kilogram per cubic meter None
• hydrocarbon resources-fluids_swabs➞diss_carb_dioxide _0..1
  • Description: Concentration of dissolved carbon dioxide in the sample or liquid portion of the sample
  • Range: QuantityValue
  • Example: 5 milligram per liter None
• hydrocarbon resources-fluids_swabs➞diss_oxygen_fluid _0..1
  • Description: Concentration of dissolved oxygen in the oil field produced fluids as it contributes to oxgen-corrosion and microbial activity (e.g. Mic).
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞vfa _0..1
  • Description: Concentration of Volatile Fatty Acids in the sample
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞benzene _0..1
  • Description: Concentration of benzene in the sample
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞toluene _0..1
  • Description: Concentration of toluene in the sample
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞ethylbenzene _0..1
  • Description: Concentration of ethylbenzene in the sample
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞xylene _0..1
  • Description: Concentration of xylene in the sample
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞api _1..1
  • Description: API gravity is a measure of how heavy or light a petroleum liquid is compared to water (source: https://en.wikipedia.org/wiki/API_gravity) (e.g. 31.1¬∞ API)
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞tan _0..1
  • Description: Total Acid Number¬†(TAN) is a measurement of acidity that is determined by the amount of¬†potassium hydroxide¬†in milligrams that is needed to neutralize the acids in one gram of oil.¬†It is an important quality measurement of¬†crude oil. (source: https://en.wikipedia.org/wiki/Total_acid_number)
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞viscosity _0..1
  • Description: A measure of oil's resistance¬†to gradual deformation by¬†shear stress¬†or¬†tensile stress (e.g. 3.5 cp; 100 ¬∞C)
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞pour_point _0..1
  • Description: Temperature at which a liquid becomes semi solid and loses its flow characteristics. In crude oil a high¬†pour point¬†is generally associated with a high paraffin content, typically found in crude deriving from a larger proportion of plant material. (soure: https://en.wikipedia.org/wiki/pour_point)
  • Range: QuantityValue
  • Example: None
• hydrocarbon resources-fluids_swabs➞saturates_pc _0..1
  • Description: Saturate, Aromatic, Resin and Asphaltene¬†(SARA) is an analysis method that divides¬†crude oil¬†components according to their polarizability and polarity. There are three main methods to obtain SARA results. The most popular one is known as the Iatroscan TLC-FID and is referred to as IP-143 (source: https://en.wikipedia.org/wiki/Saturate,_aromatic,_resin_and_asphaltene)
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞aromatics_pc _0..1
  • Description: Saturate, Aromatic, Resin and Asphaltene¬†(SARA) is an analysis method that divides¬†crude oil¬†components according to their polarizability and polarity. There are three main methods to obtain SARA results. The most popular one is known as the Iatroscan TLC-FID and is referred to as IP-143 (source: https://en.wikipedia.org/wiki/Saturate,_aromatic,_resin_and_asphaltene)
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞resins_pc _0..1
  • Description: Saturate, Aromatic, Resin and Asphaltene¬†(SARA) is an analysis method that divides¬†crude oil¬†components according to their polarizability and polarity. There are three main methods to obtain SARA results. The most popular one is known as the Iatroscan TLC-FID and is referred to as IP-143 (source: https://en.wikipedia.org/wiki/Saturate,_aromatic,_resin_and_asphaltene)
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞asphaltenes_pc _0..1
  • Description: Saturate, Aromatic, Resin and Asphaltene¬†(SARA) is an analysis method that divides¬†crude oil¬†components according to their polarizability and polarity. There are three main methods to obtain SARA results. The most popular one is known as the Iatroscan TLC-FID and is referred to as IP-143 (source: https://en.wikipedia.org/wiki/Saturate,_aromatic,_resin_and_asphaltene)
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞misc_param _0..*
  • Description: Any other measurement performed or parameter collected, that is not listed here
  • Range: String
  • Example: Bicarbonate ion concentration;2075 micromole per kilogram None
• hydrocarbon resources-fluids_swabs➞additional_info _0..1
  • Description: Information that doesn't fit anywhere else. Can also be used to propose new entries for fields with controlled vocabulary
  • Range: String
  • Example: None
• hydrocarbon resources-fluids_swabs➞samp_name _1..1
  • Description: A local identifier or name that for the material sample used for extracting nucleic acids, and subsequent sequencing. It can refer either to the original material collected or to any derived sub-samples. It can have any format, but we suggest that you make it concise, unique and consistent within your lab, and as informative as possible. INSDC requires every sample name from a single Submitter to be unique. Use of a globally unique identifier for the field source_mat_id is recommended in addition to sample_name.
  • Range: String
  • Example: ISDsoil1 None
• hydrocarbon resources-fluids_swabs➞project_name _1..1
  • Description: Name of the project within which the sequencing was organized
  • Range: String
  • Example: Forest soil metagenome None
• hydrocarbon resources-fluids_swabs➞samp_vol_we_dna_ext _0..1
  • Description: Volume (ml) or mass (g) of total collected sample processed for DNA extraction. Note: total sample collected should be entered under the term Sample Size (MIXS:0000001).
  • Range: QuantityValue
  • Example: 1500 milliliter None

Mixed in from MIGS org:

• MIGS org➞submitted_to_insdc _1..1
  • Description: Depending on the study (large-scale e.g. done with next generation sequencing technology, or small-scale) sequences have to be submitted to SRA (Sequence Read Archive), DRA (DDBJ Read Archive) or via the classical Webin/Sequin systems to Genbank, ENA and DDBJ. Although this field is mandatory, it is meant as a self-test field, therefore it is not necessary to include this field in contextual data submitted to databases
  • Range: String
  • Example: yes None

Mixed in from MIGS org:

• MIGS org➞investigation_type _1..1
  • Description: Nucleic Acid Sequence Report is the root element of all MIGS/MIMS compliant reports as standardized by Genomic Standards Consortium. This field is either eukaryote,bacteria,virus,plasmid,organelle, metagenome,mimarks-survey, mimarks-specimen, metatranscriptome, single amplified genome, metagenome-assembled genome, or uncultivated viral genome
  • Range: investigation_type_enum
  • Example: metagenome None

Mixed in from MIGS org:

• MIGS org➞samp_taxon_id _1..1
  • Description: NCBI taxon id of the sample. Maybe be a single taxon or mixed taxa sample. Use 'synthetic metagenome’ for mock community/positive controls, or 'blank sample' for negative controls.
  • Range: String
  • Example: Gut Metagenome [NCBI:txid749906] None

Mixed in from MIGS org:

• MIGS org➞experimental_factor _0..1
  • Description: Experimental factors are essentially the variable aspects of an experiment design which can be used to describe an experiment, or set of experiments, in an increasingly detailed manner. This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). For a browser of EFO (v 2.95) terms, please see http://purl.bioontology.org/ontology/EFO; for a browser of OBI (v 2018-02-12) terms please see http://purl.bioontology.org/ontology/OBI
  • Range: String
  • Example: time series design [EFO:EFO_0001779] None

Mixed in from MIGS org:

• MIGS org➞neg_cont_type _0..1
  • Description: The substance or equipment used as a negative control in an investigation
  • Range: neg_cont_type_enum
  • Example: None

Mixed in from MIGS org:

• MIGS org➞pos_cont_type _0..1
  • Description: The substance, mixture, product, or apparatus used to verify that a process which is part of an investigation delivers a true positive.
  • Range: String
  • Example: None

Mixed in from MIGS org:

• MIGS org➞env_package _0..1
  • Description: MIxS extension for reporting of measurements and observations obtained from one or more of the environments where the sample was obtained. All environmental packages listed here are further defined in separate subtables. By giving the name of the environmental package, a selection of fields can be made from the subtables and can be reported
  • Range: env_package_enum
  • Example: soil None

Mixed in from MIGS org:

• MIGS org➞subspecf_gen_lin _0..1
  • Description: Information about the genetic distinctness of the sequenced organism below the subspecies level, e.g., serovar, serotype, biotype, ecotype, or any relevant genetic typing schemes like Group I plasmid. Subspecies should not be recorded in this term, but in the NCBI taxonomy. Supply both the lineage name and the lineage rank separated by a colon, e.g., biovar:abc123.
  • Range: String
  • Example: serovar:Newport None

Mixed in from MIGS org:

• MIGS org➞extrachrom_elements _0..1
  • Description: Do plasmids exist of significant phenotypic consequence (e.g. ones that determine virulence or antibiotic resistance). Megaplasmids? Other plasmids (borrelia has 15+ plasmids)
  • Range: Integer
  • Example: 5 None

Mixed in from MIGS org:

• MIGS org➞estimated_size _0..1
  • Description: The estimated size of the genome prior to sequencing. Of particular importance in the sequencing of (eukaryotic) genome which could remain in draft form for a long or unspecified period.
  • Range: String
  • Example: 300000 bp None

Mixed in from MIGS org:

• MIGS org➞ref_biomaterial _0..1
  • Description: Primary publication if isolated before genome publication; otherwise, primary genome report.
  • Range: String
  • Example: doi:10.1016/j.syapm.2018.01.009 None

Mixed in from MIGS org:

• MIGS org➞source_mat_id _0..1
  • Description: A unique identifier assigned to a material sample (as defined by http://rs.tdwg.org/dwc/terms/materialSampleID, and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing. The identifier can refer either to the original material collected or to any derived sub-samples. The INSDC qualifiers /specimen_voucher, /bio_material, or /culture_collection may or may not share the same value as the source_mat_id field. For instance, the /specimen_voucher qualifier and source_mat_id may both contain 'UAM:Herps:14' , referring to both the specimen voucher and sampled tissue with the same identifier. However, the /culture_collection qualifier may refer to a value from an initial culture (e.g. ATCC:11775) while source_mat_id would refer to an identifier from some derived culture from which the nucleic acids were extracted (e.g. xatc123 or ark:/2154/R2).
  • Range: String
  • Example: MPI012345 None

Mixed in from MIGS org:

• MIGS org➞isol_growth_condt _1..1
  • Description: Publication reference in the form of pubmed ID (pmid), digital object identifier (doi) or url for isolation and growth condition specifications of the organism/material
  • Range: String
  • Example: doi: 10.1016/j.syapm.2018.01.009 None

Mixed in from MIGS org:

• MIGS org➞samp_collec_device _0..1
  • Description: The device used to collect an environmental sample. This field accepts terms listed under environmental sampling device (http://purl.obolibrary.org/obo/ENVO). This field also accepts terms listed under specimen collection device (http://purl.obolibrary.org/obo/GENEPIO_0002094).
  • Range: String
  • Example: swab, biopsy, niskin bottle, push core, drag swab [GENEPIO:0002713] None

Mixed in from MIGS org:

• MIGS org➞samp_collec_method _0..1
  • Description: The method employed for collecting the sample.
  • Range: String
  • Example: swabbing None

Mixed in from MIGS org:

• MIGS org➞samp_mat_process _0..1
  • Description: A brief description of any processing applied to the sample during or after retrieving the sample from environment, or a link to the relevant protocol(s) performed.
  • Range: String
  • Example: filtering of seawater, storing samples in ethanol None

Mixed in from MIGS org:

• MIGS org➞samp_size _0..1
  • Description: The total amount or size (volume (ml), mass (g) or area (m2) ) of sample collected.
  • Range: QuantityValue
  • Example: 5 liter None

Mixed in from MIGS org:

• MIGS org➞nucl_acid_ext _0..1
  • Description: A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample
  • Range: String
  • Example: https://mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf None

Mixed in from MIGS org:

• MIGS org➞nucl_acid_amp _0..1
  • Description: A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the enzymatic amplification (PCR, TMA, NASBA) of specific nucleic acids
  • Range: String
  • Example: https://phylogenomics.me/protocols/16s-pcr-protocol/ None

Mixed in from MIGS org:

• MIGS org➞lib_size _0..1
  • Description: Total number of clones in the library prepared for the project
  • Range: Integer
  • Example: 50 None

Mixed in from MIGS org:

• MIGS org➞lib_reads_seqd _0..1
  • Description: Total number of clones sequenced from the library
  • Range: Integer
  • Example: 20 None

Mixed in from MIGS org:

• MIGS org➞lib_layout _0..1
  • Description: Specify whether to expect single, paired, or other configuration of reads
  • Range: lib_layout_enum
  • Example: paired None

Mixed in from MIGS org:

• MIGS org➞lib_vector _0..1
  • Description: Cloning vector type(s) used in construction of libraries
  • Range: String
  • Example: Bacteriophage P1 None

Mixed in from MIGS org:

• MIGS org➞lib_screen _0..1
  • Description: Specific enrichment or screening methods applied before and/or after creating libraries
  • Range: String
  • Example: enriched, screened, normalized None

Mixed in from MIGS org:

• MIGS org➞adapters _0..1
  • Description: Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters
  • Range: String
  • Example: AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT None

Mixed in from MIGS org:

• MIGS org➞seq_meth _1..1
  • Description: Sequencing machine used. Where possible the term should be taken from the OBI list of DNA sequencers (http://purl.obolibrary.org/obo/OBI_0400103).
  • Range: String
  • Example: 454 Genome Sequencer FLX [OBI:0000702] None

Mixed in from MIGS org:

• MIGS org➞tax_ident _0..1
  • Description: The phylogenetic marker(s) used to assign an organism name to the SAG or MAG
  • Range: tax_ident_enum
  • Example: other: rpoB gene None

Mixed in from MIGS org:

• MIGS org➞assembly_qual _0..1
  • Description: The assembly quality category is based on sets of criteria outlined for each assembly quality category. For MISAG/MIMAG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities with a consensus error rate equivalent to Q50 or better. High Quality Draft:Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs. Medium Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Low Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to total assembly size, number of contigs, contig N50/L50, and maximum contig length. For MIUVIG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities, with extensive manual review and editing to annotate putative gene functions and transcriptional units. High-quality draft genome: One or multiple fragments, totaling ≥ 90% of the expected genome or replicon sequence or predicted complete. Genome fragment(s): One or multiple fragments, totalling < 90% of the expected genome or replicon sequence, or for which no genome size could be estimated
  • Range: assembly_qual_enum
  • Example: High-quality draft genome None

Mixed in from MIGS org:

• MIGS org➞assembly_name _0..1
  • Description: Name/version of the assembly provided by the submitter that is used in the genome browsers and in the community
  • Range: String
  • Example: HuRef, JCVI_ISG_i3_1.0 None

Mixed in from MIGS org:

• MIGS org➞assembly_software _1..1
  • Description: Tool(s) used for assembly, including version number and parameters
  • Range: String
  • Example: metaSPAdes;3.11.0;kmer set 21,33,55,77,99,121, default parameters otherwise None

Mixed in from MIGS org:

• MIGS org➞annot _0..1
  • Description: Tool used for annotation, or for cases where annotation was provided by a community jamboree or model organism database rather than by a specific submitter
  • Range: String
  • Example: prokka None

Mixed in from MIGS org:

• MIGS org➞number_contig _0..1
  • Description: Total number of contigs in the cleaned/submitted assembly that makes up a given genome, SAG, MAG, or UViG
  • Range: Integer
  • Example: 40 None

Mixed in from MIGS org:

• MIGS org➞feat_pred _0..1
  • Description: Method used to predict UViGs features such as ORFs, integration site, etc.
  • Range: String
  • Example: Prodigal;2.6.3;default parameters None

Mixed in from MIGS org:

• MIGS org➞ref_db _0..1
  • Description: List of database(s) used for ORF annotation, along with version number and reference to website or publication
  • Range: String
  • Example: pVOGs;5;http://dmk-brain.ecn.uiowa.edu/pVOGs/ Grazziotin et al. 2017 doi:10.1093/nar/gkw975 None

Mixed in from MIGS org:

• MIGS org➞sim_search_meth _0..1
  • Description: Tool used to compare ORFs with database, along with version and cutoffs used
  • Range: String
  • Example: HMMER3;3.1b2;hmmsearch, cutoff of 50 on score None

Mixed in from MIGS org:

• MIGS org➞tax_class _0..1
  • Description: Method used for taxonomic classification, along with reference database used, classification rank, and thresholds used to classify new genomes
  • Range: String
  • Example: vConTACT vContact2 (references from NCBI RefSeq v83, genus rank classification, default parameters) None

Mixed in from MIGS org:

• MIGS org➞compl_score _0..1
  • Description: Completeness score is typically based on either the fraction of markers found as compared to a database or the percent of a genome found as compared to a closely related reference genome. High Quality Draft: >90%, Medium Quality Draft: >50%, and Low Quality Draft: < 50% should have the indicated completeness scores
  • Range: compl_score_enum
  • Example: med;60% None

Mixed in from MIGS org:

• MIGS org➞compl_software _0..1
  • Description: Tools used for completion estimate, i.e. checkm, anvi'o, busco
  • Range: String
  • Example: checkm None

Mixed in from MIGS org:

• MIGS org➞associated resource _0..1
  • Description: A related resource that is referenced, cited, or otherwise associated to the sequence.
  • Range: String
  • Example: http://www.earthmicrobiome.org/ None

Mixed in from MIGS org:

• MIGS org➞sop _0..1
  • Description: Standard operating procedures used in assembly and/or annotation of genomes, metagenomes or environmental sequences
  • Range: String
  • Example: http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/ None