Class: human-vaginal MIMS

Combinatorial checklist Metagenome or Environmental with environmental package human-vaginal

URI: mixs.vocab:Human-vaginalMIMS

Parents

• is_a: Human-vaginal - human-vaginal

Uses Mixin

• mixin: MIMS - Metagenome or Environmental

Attributes

Inherited from human-vaginal:

• lat_lon _0..1
  • Description: The geographical origin of the sample as defined by latitude and longitude. The values should be reported in decimal degrees and in WGS84 system
  • Range: String
  • Example: 50.586825 6.408977 None
• depth _0..1
  • Description: The vertical distance below local surface, e.g. for sediment or soil samples depth is measured from sediment or soil surface, respectively. Depth can be reported as an interval for subsurface samples.
  • Range: QuantityValue
  • Example: 10 meter None
• alt _0..1
  • Description: Altitude is a term used to identify heights of objects such as airplanes, space shuttles, rockets, atmospheric balloons and heights of places such as atmospheric layers and clouds. It is used to measure the height of an object which is above the earth's surface. In this context, the altitude measurement is the vertical distance between the earth's surface above sea level and the sampled position in the air
  • Range: QuantityValue
  • Example: 100 meter None
• elev _0..1
  • Description: Elevation of the sampling site is its height above a fixed reference point, most commonly the mean sea level. Elevation is mainly used when referring to points on the earth's surface, while altitude is used for points above the surface, such as an aircraft in flight or a spacecraft in orbit.
  • Range: QuantityValue
  • Example: 100 meter None
• human-vaginal➞temp _0..1
  • Description: Temperature of the sample at the time of sampling.
  • Range: QuantityValue
  • Example: 25 degree Celsius None
• geo_loc_name _0..1
  • Description: The geographical origin of the sample as defined by the country or sea name followed by specific region name. Country or sea names should be chosen from the INSDC country list (http://insdc.org/country.html), or the GAZ ontology (http://purl.bioontology.org/ontology/GAZ)
  • Range: String
  • Example: USA: Maryland, Bethesda None
• collection_date _0..1
  • Description: The time of sampling, either as an instance (single point in time) or interval. In case no exact time is available, the date/time can be right truncated i.e. all of these are valid times: 2008-01-23T19:23:10+00:00; 2008-01-23T19:23:10; 2008-01-23; 2008-01; 2008; Except: 2008-01; 2008 all are ISO8601 compliant
  • Range: Date
  • Example: 2018-05-11T10:00:00+01:00; 2018-05-11 None
• env_broad_scale _0..1
  • Description: Report the major environmental system the sample or specimen came from. The system(s) identified should have a coarse spatial grain, to provide the general environmental context of where the sampling was done (e.g. in the desert or a rainforest). We recommend using subclasses of EnvO’s biome class: http://purl.obolibrary.org/obo/ENVO_00000428. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS
  • Range: String
  • Example: oceanic epipelagic zone biome [ENVO:01000033] for annotating a water sample from the photic zone in middle of the Atlantic Ocean None
• env_local_scale _0..1
  • Description: Report the entity or entities which are in the sample or specimen’s local vicinity and which you believe have significant causal influences on your sample or specimen. We recommend using EnvO terms which are of smaller spatial grain than your entry for env_broad_scale. Terms, such as anatomical sites, from other OBO Library ontologies which interoperate with EnvO (e.g. UBERON) are accepted in this field. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS.
  • Range: String
  • Example: litter layer [ENVO:01000338]; Annotating a pooled sample taken from various vegetation layers in a forest consider: canopy [ENVO:00000047]|herb and fern layer [ENVO:01000337]|litter layer [ENVO:01000338]|understory [01000335]|shrub layer [ENVO:01000336]. None
• env_medium _0..1
  • Description: Report the environmental material(s) immediately surrounding the sample or specimen at the time of sampling. We recommend using subclasses of 'environmental material' (http://purl.obolibrary.org/obo/ENVO_00010483). EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS . Terms from other OBO ontologies are permissible as long as they reference mass/volume nouns (e.g. air, water, blood) and not discrete, countable entities (e.g. a tree, a leaf, a table top).
  • Range: String
  • Example: soil [ENVO:00001998]; Annotating a fish swimming in the upper 100 m of the Atlantic Ocean, consider: ocean water [ENVO:00002151]. Example: Annotating a duck on a pond consider: pond water [ENVO:00002228]|air [ENVO_00002005] None
• human-vaginal➞menarche _0..1
  • Description: Date of most recent menstruation
  • Range: Date
  • Example: 2018-05-11 None
• human-vaginal➞sexual_act _0..1
  • Description: Current sexual partner and frequency of sex
  • Range: String
  • Example: None
• human-vaginal➞pregnancy _0..1
  • Description: Date due of pregnancy
  • Range: Date
  • Example: 2018-05-11 None
• human-vaginal➞douche _0..1
  • Description: Date of most recent douche
  • Range: Date
  • Example: 2018-05-11 None
• human-vaginal➞birth_control _0..1
  • Description: Specification of birth control medication used
  • Range: String
  • Example: None
• human-vaginal➞menopause _0..1
  • Description: Date of onset of menopause
  • Range: Date
  • Example: 2018-05-11 None
• human-vaginal➞hrt _0..1
  • Description: Whether subject had hormone replacement theraphy, and if yes start date
  • Range: Date
  • Example: 2018-05-11 None
• human-vaginal➞hysterectomy _0..1
  • Description: Specification of whether hysterectomy was performed
  • Range: String
  • Example: no None
• human-vaginal➞gynecologic_disord _0..*
  • Description: History of gynecological disorders; can include multiple disorders. The terms should be chosen from the DO (Human Disease Ontology) at http://www.disease-ontology.org, female reproductive system disease (https://disease-ontology.org/?id=DOID:229).
  • Range: String
  • Example: None
• human-vaginal➞urogenit_disord _0..*
  • Description: History of urogenital disorders, can include multiple disorders. The terms should be chosen from the DO (Human Disease Ontology) at http://www.disease-ontology.org, reproductive system disease (https://disease-ontology.org/?id=DOID:15) or urinary system disease (https://disease-ontology.org/?id=DOID:18).
  • Range: String
  • Example: None
• human-vaginal➞host_subject_id _0..1
  • Description: A unique identifier by which each subject can be referred to, de-identified.
  • Range: String
  • Example: MPI123 None
• human-vaginal➞host_age _0..1
  • Description: Age of host at the time of sampling; relevant scale depends on species and study, e.g. Could be seconds for amoebae or centuries for trees
  • Range: QuantityValue
  • Example: 10 days None
• human-vaginal➞host_sex _0..1
  • Description: Gender or physical sex of the host.
  • Range: host_sex_enum
  • Example: non-binary None
• human-vaginal➞ihmc_medication_code _0..*
  • Description: Can include multiple medication codes
  • Range: Integer
  • Example: 810 None
• human-vaginal➞chem_administration _0..*
  • Description: List of chemical compounds administered to the host or site where sampling occurred, and when (e.g. Antibiotics, n fertilizer, air filter); can include multiple compounds. For chemical entities of biological interest ontology (chebi) (v 163), http://purl.bioontology.org/ontology/chebi
  • Range: String
  • Example: agar [CHEBI:2509];2018-05-11T20:00Z None
• human-vaginal➞host_body_site _0..1
  • Description: Name of body site where the sample was obtained from, such as a specific organ or tissue (tongue, lung etc...). For foundational model of anatomy ontology (fma) (v 4.11.0) or Uber-anatomy ontology (UBERON) (v releases/2014-06-15) terms, please see http://purl.bioontology.org/ontology/FMA or http://purl.bioontology.org/ontology/UBERON
  • Range: String
  • Example: gill [UBERON:0002535] None
• human-vaginal➞host_body_product _0..1
  • Description: Substance produced by the body, e.g. Stool, mucus, where the sample was obtained from. For foundational model of anatomy ontology (fma) or Uber-anatomy ontology (UBERON) terms, please see https://www.ebi.ac.uk/ols/ontologies/fma or https://www.ebi.ac.uk/ols/ontologies/uberon
  • Range: String
  • Example: Portion of mucus [fma66938] None
• human-vaginal➞host_tot_mass _0..1
  • Description: Total mass of the host at collection, the unit depends on host
  • Range: QuantityValue
  • Example: 2500 gram None
• human-vaginal➞host_height _0..1
  • Description: The height of subject
  • Range: QuantityValue
  • Example: 0.1 meter None
• human-vaginal➞host_diet _0..*
  • Description: Type of diet depending on the host, for animals omnivore, herbivore etc., for humans high-fat, meditteranean etc.; can include multiple diet types
  • Range: String
  • Example: herbivore None
• human-vaginal➞host_last_meal _0..*
  • Description: Content of last meal and time since feeding; can include multiple values
  • Range: String
  • Example: corn feed;P2H None
• human-vaginal➞host_family_relation _0..*
  • Description: Familial relationships to other hosts in the same study; can include multiple relationships
  • Range: String
  • Example: offspring;Mussel25 None
• human-vaginal➞host_genotype _0..1
  • Description: Observed genotype
  • Range: String
  • Example: C57BL/6 None
• human-vaginal➞host_phenotype _0..1
  • Description: Phenotype of human or other host. For phenotypic quality ontology (pato) (v 2018-03-27) terms, please see http://purl.bioontology.org/ontology/pato. For Human Phenotype Ontology (HP) (v 2018-06-13) please see http://purl.bioontology.org/ontology/HP
  • Range: String
  • Example: elongated [PATO:0001154] None
• human-vaginal➞host_body_temp _0..1
  • Description: Core body temperature of the host when sample was collected
  • Range: QuantityValue
  • Example: 15 degree Celsius None
• human-vaginal➞host_body_mass_index _0..1
  • Description: Body mass index, calculated as weight/(height)squared
  • Range: QuantityValue
  • Example: 22 kilogram per square meter None
• human-vaginal➞ethnicity _0..*
  • Description: A category of people who identify with each other, usually on the basis of presumed similarities such as a common language, ancestry, history, society, culture, nation or social treatment within their residing area. https://en.wikipedia.org/wiki/List_of_contemporary_ethnic_groups
  • Range: String
  • Example: native american None
• human-vaginal➞host_occupation _0..1
  • Description: Most frequent job performed by subject
  • Range: Integer
  • Example: veterinary None
• human-vaginal➞medic_hist_perform _0..1
  • Description: Whether full medical history was collected
  • Range: String
  • Example: TRUE None
• human-vaginal➞host_pulse _0..1
  • Description: Resting pulse, measured as beats per minute
  • Range: QuantityValue
  • Example: 65 beats per minute None
• human-vaginal➞perturbation _0..*
  • Description: Type of perturbation, e.g. chemical administration, physical disturbance, etc., coupled with perturbation regimen including how many times the perturbation was repeated, how long each perturbation lasted, and the start and end time of the entire perturbation period; can include multiple perturbation types
  • Range: String
  • Example: antibiotic addition;R2/2018-05-11T14:30Z/2018-05-11T19:30Z/P1H30M None
• human-vaginal➞samp_salinity _0..1
  • Description: Salinity is the total concentration of all dissolved salts in a liquid or solid (in the form of an extract obtained by centrifugation) sample. While salinity can be measured by a complete chemical analysis, this method is difficult and time consuming. More often, it is instead derived from the conductivity measurement. This is known as practical salinity. These derivations compare the specific conductance of the sample to a salinity standard such as seawater
  • Range: QuantityValue
  • Example: 1 milligram per liter None
• human-vaginal➞salinity _0..1
  • Description: The total concentration of all dissolved salts in a liquid or solid sample. While salinity can be measured by a complete chemical analysis, this method is difficult and time consuming. More often, it is instead derived from the conductivity measurement. This is known as practical salinity. These derivations compare the specific conductance of the sample to a salinity standard such as seawater.
  • Range: QuantityValue
  • Example: 25 practical salinity unit None
• human-vaginal➞oxy_stat_samp _0..1
  • Description: Oxygenation status of sample
  • Range: oxy_stat_samp_enum
  • Example: aerobic None
• human-vaginal➞organism_count _0..*
  • Description: Total cell count of any organism (or group of organisms) per gram, volume or area of sample, should include name of organism followed by count. The method that was used for the enumeration (e.g. qPCR, atp, mpn, etc.) Should also be provided. (example: total prokaryotes; 3.5e7 cells per ml; qpcr)
  • Range: organism_count_enum
  • Example: total prokaryotes;3.5e7 cells per milliliter;qPCR None
• human-vaginal➞samp_store_temp _0..1
  • Description: Temperature at which sample was stored, e.g. -80 degree Celsius
  • Range: QuantityValue
  • Example: -80 degree Celsius None
• human-vaginal➞samp_store_loc _0..1
  • Description: Location at which sample was stored, usually name of a specific freezer/room
  • Range: String
  • Example: Freezer no:5 None
• human-vaginal➞samp_store_dur _0..1
  • Description: Duration for which the sample was stored
  • Range: String
  • Example: P1Y6M None
• human-vaginal➞host_symbiont _0..*
  • Description: The taxonomic name of the organism(s) found living in mutualistic, commensalistic, or parasitic symbiosis with the specific host.
  • Range: String
  • Example: flukeworms None
• human-vaginal➞misc_param _0..*
  • Description: Any other measurement performed or parameter collected, that is not listed here
  • Range: String
  • Example: Bicarbonate ion concentration;2075 micromole per kilogram None
• human-vaginal➞samp_name _1..1
  • Description: A local identifier or name that for the material sample used for extracting nucleic acids, and subsequent sequencing. It can refer either to the original material collected or to any derived sub-samples. It can have any format, but we suggest that you make it concise, unique and consistent within your lab, and as informative as possible. INSDC requires every sample name from a single Submitter to be unique. Use of a globally unique identifier for the field source_mat_id is recommended in addition to sample_name.
  • Range: String
  • Example: ISDsoil1 None
• human-vaginal➞project_name _1..1
  • Description: Name of the project within which the sequencing was organized
  • Range: String
  • Example: Forest soil metagenome None
• human-vaginal➞host_disease_stat _0..1
  • Description: List of diseases with which the host has been diagnosed; can include multiple diagnoses. The value of the field depends on host; for humans the terms should be chosen from the DO (Human Disease Ontology) at https://www.disease-ontology.org, non-human host diseases are free text
  • Range: String
  • Example: rabies [DOID:11260] None
• human-vaginal➞samp_vol_we_dna_ext _0..1
  • Description: Volume (ml) or mass (g) of total collected sample processed for DNA extraction. Note: total sample collected should be entered under the term Sample Size (MIXS:0000001).
  • Range: QuantityValue
  • Example: 1500 milliliter None

Mixed in from MIMS:

• MIMS➞submitted_to_insdc _1..1
  • Description: Depending on the study (large-scale e.g. done with next generation sequencing technology, or small-scale) sequences have to be submitted to SRA (Sequence Read Archive), DRA (DDBJ Read Archive) or via the classical Webin/Sequin systems to Genbank, ENA and DDBJ. Although this field is mandatory, it is meant as a self-test field, therefore it is not necessary to include this field in contextual data submitted to databases
  • Range: String
  • Example: yes None

Mixed in from MIMS:

• MIMS➞investigation_type _1..1
  • Description: Nucleic Acid Sequence Report is the root element of all MIGS/MIMS compliant reports as standardized by Genomic Standards Consortium. This field is either eukaryote,bacteria,virus,plasmid,organelle, metagenome,mimarks-survey, mimarks-specimen, metatranscriptome, single amplified genome, metagenome-assembled genome, or uncultivated viral genome
  • Range: investigation_type_enum
  • Example: metagenome None

Mixed in from MIMS:

• MIMS➞samp_taxon_id _1..1
  • Description: NCBI taxon id of the sample. Maybe be a single taxon or mixed taxa sample. Use 'synthetic metagenome’ for mock community/positive controls, or 'blank sample' for negative controls.
  • Range: String
  • Example: Gut Metagenome [NCBI:txid749906] None

Mixed in from MIMS:

• MIMS➞experimental_factor _0..1
  • Description: Experimental factors are essentially the variable aspects of an experiment design which can be used to describe an experiment, or set of experiments, in an increasingly detailed manner. This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). For a browser of EFO (v 2.95) terms, please see http://purl.bioontology.org/ontology/EFO; for a browser of OBI (v 2018-02-12) terms please see http://purl.bioontology.org/ontology/OBI
  • Range: String
  • Example: time series design [EFO:EFO_0001779] None

Mixed in from MIMS:

• MIMS➞neg_cont_type _0..1
  • Description: The substance or equipment used as a negative control in an investigation
  • Range: neg_cont_type_enum
  • Example: None

Mixed in from MIMS:

• MIMS➞pos_cont_type _0..1
  • Description: The substance, mixture, product, or apparatus used to verify that a process which is part of an investigation delivers a true positive.
  • Range: String
  • Example: None

Mixed in from MIMS:

• MIMS➞env_package _0..1
  • Description: MIxS extension for reporting of measurements and observations obtained from one or more of the environments where the sample was obtained. All environmental packages listed here are further defined in separate subtables. By giving the name of the environmental package, a selection of fields can be made from the subtables and can be reported
  • Range: env_package_enum
  • Example: soil None

Mixed in from MIMS:

• MIMS➞ref_biomaterial _0..1
  • Description: Primary publication if isolated before genome publication; otherwise, primary genome report.
  • Range: String
  • Example: doi:10.1016/j.syapm.2018.01.009 None

Mixed in from MIMS:

• MIMS➞source_mat_id _0..1
  • Description: A unique identifier assigned to a material sample (as defined by http://rs.tdwg.org/dwc/terms/materialSampleID, and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing. The identifier can refer either to the original material collected or to any derived sub-samples. The INSDC qualifiers /specimen_voucher, /bio_material, or /culture_collection may or may not share the same value as the source_mat_id field. For instance, the /specimen_voucher qualifier and source_mat_id may both contain 'UAM:Herps:14' , referring to both the specimen voucher and sampled tissue with the same identifier. However, the /culture_collection qualifier may refer to a value from an initial culture (e.g. ATCC:11775) while source_mat_id would refer to an identifier from some derived culture from which the nucleic acids were extracted (e.g. xatc123 or ark:/2154/R2).
  • Range: String
  • Example: MPI012345 None

Mixed in from MIMS:

• MIMS➞rel_to_oxygen _0..1
  • Description: Is this organism an aerobe, anaerobe? Please note that aerobic and anaerobic are valid descriptors for microbial environments
  • Range: rel_to_oxygen_enum
  • Example: aerobe None

Mixed in from MIMS:

• MIMS➞samp_collec_device _0..1
  • Description: The device used to collect an environmental sample. This field accepts terms listed under environmental sampling device (http://purl.obolibrary.org/obo/ENVO). This field also accepts terms listed under specimen collection device (http://purl.obolibrary.org/obo/GENEPIO_0002094).
  • Range: String
  • Example: swab, biopsy, niskin bottle, push core, drag swab [GENEPIO:0002713] None

Mixed in from MIMS:

• MIMS➞samp_collec_method _0..1
  • Description: The method employed for collecting the sample.
  • Range: String
  • Example: swabbing None

Mixed in from MIMS:

• MIMS➞samp_mat_process _0..1
  • Description: A brief description of any processing applied to the sample during or after retrieving the sample from environment, or a link to the relevant protocol(s) performed.
  • Range: String
  • Example: filtering of seawater, storing samples in ethanol None

Mixed in from MIMS:

• MIMS➞size_frac _0..1
  • Description: Filtering pore size used in sample preparation
  • Range: String
  • Example: 0-0.22 micrometer None

Mixed in from MIMS:

• MIMS➞samp_size _0..1
  • Description: The total amount or size (volume (ml), mass (g) or area (m2) ) of sample collected.
  • Range: QuantityValue
  • Example: 5 liter None

Mixed in from MIMS:

• MIMS➞nucl_acid_ext _0..1
  • Description: A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample
  • Range: String
  • Example: https://mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf None

Mixed in from MIMS:

• MIMS➞nucl_acid_amp _0..1
  • Description: A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the enzymatic amplification (PCR, TMA, NASBA) of specific nucleic acids
  • Range: String
  • Example: https://phylogenomics.me/protocols/16s-pcr-protocol/ None

Mixed in from MIMS:

• MIMS➞lib_size _0..1
  • Description: Total number of clones in the library prepared for the project
  • Range: Integer
  • Example: 50 None

Mixed in from MIMS:

• MIMS➞lib_reads_seqd _0..1
  • Description: Total number of clones sequenced from the library
  • Range: Integer
  • Example: 20 None

Mixed in from MIMS:

• MIMS➞lib_layout _0..1
  • Description: Specify whether to expect single, paired, or other configuration of reads
  • Range: lib_layout_enum
  • Example: paired None

Mixed in from MIMS:

• MIMS➞lib_vector _0..1
  • Description: Cloning vector type(s) used in construction of libraries
  • Range: String
  • Example: Bacteriophage P1 None

Mixed in from MIMS:

• MIMS➞lib_screen _0..1
  • Description: Specific enrichment or screening methods applied before and/or after creating libraries
  • Range: String
  • Example: enriched, screened, normalized None

Mixed in from MIMS:

• MIMS➞mid _0..1
  • Description: Molecular barcodes, called Multiplex Identifiers (MIDs), that are used to specifically tag unique samples in a sequencing run. Sequence should be reported in uppercase letters
  • Range: String
  • Example: GTGAATAT None

Mixed in from MIMS:

• MIMS➞adapters _0..1
  • Description: Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters
  • Range: String
  • Example: AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT None

Mixed in from MIMS:

• MIMS➞seq_meth _1..1
  • Description: Sequencing machine used. Where possible the term should be taken from the OBI list of DNA sequencers (http://purl.obolibrary.org/obo/OBI_0400103).
  • Range: String
  • Example: 454 Genome Sequencer FLX [OBI:0000702] None

Mixed in from MIMS:

• MIMS➞assembly_qual _0..1
  • Description: The assembly quality category is based on sets of criteria outlined for each assembly quality category. For MISAG/MIMAG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities with a consensus error rate equivalent to Q50 or better. High Quality Draft:Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs. Medium Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Low Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to total assembly size, number of contigs, contig N50/L50, and maximum contig length. For MIUVIG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities, with extensive manual review and editing to annotate putative gene functions and transcriptional units. High-quality draft genome: One or multiple fragments, totaling ≥ 90% of the expected genome or replicon sequence or predicted complete. Genome fragment(s): One or multiple fragments, totalling < 90% of the expected genome or replicon sequence, or for which no genome size could be estimated
  • Range: assembly_qual_enum
  • Example: High-quality draft genome None

Mixed in from MIMS:

• MIMS➞assembly_name _0..1
  • Description: Name/version of the assembly provided by the submitter that is used in the genome browsers and in the community
  • Range: String
  • Example: HuRef, JCVI_ISG_i3_1.0 None

Mixed in from MIMS:

• MIMS➞assembly_software _0..1
  • Description: Tool(s) used for assembly, including version number and parameters
  • Range: String
  • Example: metaSPAdes;3.11.0;kmer set 21,33,55,77,99,121, default parameters otherwise None

Mixed in from MIMS:

• MIMS➞annot _0..1
  • Description: Tool used for annotation, or for cases where annotation was provided by a community jamboree or model organism database rather than by a specific submitter
  • Range: String
  • Example: prokka None

Mixed in from MIMS:

• MIMS➞number_contig _0..1
  • Description: Total number of contigs in the cleaned/submitted assembly that makes up a given genome, SAG, MAG, or UViG
  • Range: Integer
  • Example: 40 None

Mixed in from MIMS:

• MIMS➞feat_pred _0..1
  • Description: Method used to predict UViGs features such as ORFs, integration site, etc.
  • Range: String
  • Example: Prodigal;2.6.3;default parameters None

Mixed in from MIMS:

• MIMS➞ref_db _0..1
  • Description: List of database(s) used for ORF annotation, along with version number and reference to website or publication
  • Range: String
  • Example: pVOGs;5;http://dmk-brain.ecn.uiowa.edu/pVOGs/ Grazziotin et al. 2017 doi:10.1093/nar/gkw975 None

Mixed in from MIMS:

• MIMS➞sim_search_meth _0..1
  • Description: Tool used to compare ORFs with database, along with version and cutoffs used
  • Range: String
  • Example: HMMER3;3.1b2;hmmsearch, cutoff of 50 on score None

Mixed in from MIMS:

• MIMS➞tax_class _0..1
  • Description: Method used for taxonomic classification, along with reference database used, classification rank, and thresholds used to classify new genomes
  • Range: String
  • Example: vConTACT vContact2 (references from NCBI RefSeq v83, genus rank classification, default parameters) None

Mixed in from MIMS:

• MIMS➞associated resource _0..1
  • Description: A related resource that is referenced, cited, or otherwise associated to the sequence.
  • Range: String
  • Example: http://www.earthmicrobiome.org/ None

Mixed in from MIMS:

• MIMS➞sop _0..1
  • Description: Standard operating procedures used in assembly and/or annotation of genomes, metagenomes or environmental sequences
  • Range: String
  • Example: http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/ None