Class: host-associated MIUVIG

Combinatorial checklist Minimum Information About an Uncultivated Virus Genome with environmental package host-associated

URI: mixs.vocab:Host-associatedMIUVIG

Parents

• is_a: Host-associated - host-associated

Uses Mixin

• mixin: MIUVIG - Minimum Information About an Uncultivated Virus Genome

Attributes

Inherited from host-associated:

• lat_lon _0..1
  • Description: The geographical origin of the sample as defined by latitude and longitude. The values should be reported in decimal degrees and in WGS84 system
  • Range: String
  • Example: 50.586825 6.408977 None
• host-associated➞depth _0..1
  • Description: The vertical distance below local surface, e.g. for sediment or soil samples depth is measured from sediment or soil surface, respectively. Depth can be reported as an interval for subsurface samples.
  • Range: QuantityValue
  • Example: 10 meter None
• host-associated➞alt _0..1
  • Description: Altitude is a term used to identify heights of objects such as airplanes, space shuttles, rockets, atmospheric balloons and heights of places such as atmospheric layers and clouds. It is used to measure the height of an object which is above the earth's surface. In this context, the altitude measurement is the vertical distance between the earth's surface above sea level and the sampled position in the air
  • Range: QuantityValue
  • Example: 100 meter None
• host-associated➞elev _0..1
  • Description: Elevation of the sampling site is its height above a fixed reference point, most commonly the mean sea level. Elevation is mainly used when referring to points on the earth's surface, while altitude is used for points above the surface, such as an aircraft in flight or a spacecraft in orbit.
  • Range: QuantityValue
  • Example: 100 meter None
• host-associated➞temp _0..1
  • Description: Temperature of the sample at the time of sampling.
  • Range: QuantityValue
  • Example: 25 degree Celsius None
• geo_loc_name _0..1
  • Description: The geographical origin of the sample as defined by the country or sea name followed by specific region name. Country or sea names should be chosen from the INSDC country list (http://insdc.org/country.html), or the GAZ ontology (http://purl.bioontology.org/ontology/GAZ)
  • Range: String
  • Example: USA: Maryland, Bethesda None
• collection_date _0..1
  • Description: The time of sampling, either as an instance (single point in time) or interval. In case no exact time is available, the date/time can be right truncated i.e. all of these are valid times: 2008-01-23T19:23:10+00:00; 2008-01-23T19:23:10; 2008-01-23; 2008-01; 2008; Except: 2008-01; 2008 all are ISO8601 compliant
  • Range: Date
  • Example: 2018-05-11T10:00:00+01:00; 2018-05-11 None
• env_broad_scale _0..1
  • Description: Report the major environmental system the sample or specimen came from. The system(s) identified should have a coarse spatial grain, to provide the general environmental context of where the sampling was done (e.g. in the desert or a rainforest). We recommend using subclasses of EnvO’s biome class: http://purl.obolibrary.org/obo/ENVO_00000428. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS
  • Range: String
  • Example: oceanic epipelagic zone biome [ENVO:01000033] for annotating a water sample from the photic zone in middle of the Atlantic Ocean None
• env_local_scale _0..1
  • Description: Report the entity or entities which are in the sample or specimen’s local vicinity and which you believe have significant causal influences on your sample or specimen. We recommend using EnvO terms which are of smaller spatial grain than your entry for env_broad_scale. Terms, such as anatomical sites, from other OBO Library ontologies which interoperate with EnvO (e.g. UBERON) are accepted in this field. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS.
  • Range: String
  • Example: litter layer [ENVO:01000338]; Annotating a pooled sample taken from various vegetation layers in a forest consider: canopy [ENVO:00000047]|herb and fern layer [ENVO:01000337]|litter layer [ENVO:01000338]|understory [01000335]|shrub layer [ENVO:01000336]. None
• env_medium _0..1
  • Description: Report the environmental material(s) immediately surrounding the sample or specimen at the time of sampling. We recommend using subclasses of 'environmental material' (http://purl.obolibrary.org/obo/ENVO_00010483). EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS . Terms from other OBO ontologies are permissible as long as they reference mass/volume nouns (e.g. air, water, blood) and not discrete, countable entities (e.g. a tree, a leaf, a table top).
  • Range: String
  • Example: soil [ENVO:00001998]; Annotating a fish swimming in the upper 100 m of the Atlantic Ocean, consider: ocean water [ENVO:00002151]. Example: Annotating a duck on a pond consider: pond water [ENVO:00002228]|air [ENVO_00002005] None
• host-associated➞ances_data _0..1
  • Description: Information about either pedigree or other ancestral information description (e.g. parental variety in case of mutant or selection), e.g. A/3*B (meaning [(A x B) x B] x B)
  • Range: String
  • Example: A/3*B None
• host-associated➞biol_stat _0..1
  • Description: The level of genome modification.
  • Range: biol_stat_enum
  • Example: natural None
• host-associated➞genetic_mod _0..1
  • Description: Genetic modifications of the genome of an organism, which may occur naturally by spontaneous mutation, or be introduced by some experimental means, e.g. specification of a transgene or the gene knocked-out or details of transient transfection
  • Range: String
  • Example: aox1A transgenic None
• host-associated➞host_common_name _0..1
  • Description: Common name of the host.
  • Range: String
  • Example: human None
• host-associated➞samp_capt_status _0..1
  • Description: Reason for the sample
  • Range: samp_capt_status_enum
  • Example: farm sample None
• host-associated➞samp_dis_stage _0..1
  • Description: Stage of the disease at the time of sample collection, e.g. inoculation, penetration, infection, growth and reproduction, dissemination of pathogen.
  • Range: samp_dis_stage_enum
  • Example: infection None
• host-associated➞host_taxid _0..1
  • Description: NCBI taxon id of the host, e.g. 9606
  • Range: String
  • Example: 7955 None
• host-associated➞host_subject_id _0..1
  • Description: A unique identifier by which each subject can be referred to, de-identified.
  • Range: String
  • Example: MPI123 None
• host-associated➞host_age _0..1
  • Description: Age of host at the time of sampling; relevant scale depends on species and study, e.g. Could be seconds for amoebae or centuries for trees
  • Range: QuantityValue
  • Example: 10 days None
• host-associated➞host_life_stage _0..1
  • Description: Description of life stage of host
  • Range: String
  • Example: adult None
• host-associated➞host_sex _0..1
  • Description: Gender or physical sex of the host.
  • Range: host_sex_enum
  • Example: non-binary None
• host-associated➞chem_administration _0..*
  • Description: List of chemical compounds administered to the host or site where sampling occurred, and when (e.g. Antibiotics, n fertilizer, air filter); can include multiple compounds. For chemical entities of biological interest ontology (chebi) (v 163), http://purl.bioontology.org/ontology/chebi
  • Range: String
  • Example: agar [CHEBI:2509];2018-05-11T20:00Z None
• host-associated➞host_body_habitat _0..1
  • Description: Original body habitat where the sample was obtained from
  • Range: String
  • Example: nasopharynx None
• host-associated➞host_body_site _0..1
  • Description: Name of body site where the sample was obtained from, such as a specific organ or tissue (tongue, lung etc...). For foundational model of anatomy ontology (fma) (v 4.11.0) or Uber-anatomy ontology (UBERON) (v releases/2014-06-15) terms, please see http://purl.bioontology.org/ontology/FMA or http://purl.bioontology.org/ontology/UBERON
  • Range: String
  • Example: gill [UBERON:0002535] None
• host-associated➞host_body_product _0..1
  • Description: Substance produced by the body, e.g. Stool, mucus, where the sample was obtained from. For foundational model of anatomy ontology (fma) or Uber-anatomy ontology (UBERON) terms, please see https://www.ebi.ac.uk/ols/ontologies/fma or https://www.ebi.ac.uk/ols/ontologies/uberon
  • Range: String
  • Example: Portion of mucus [fma66938] None
• host-associated➞host_tot_mass _0..1
  • Description: Total mass of the host at collection, the unit depends on host
  • Range: QuantityValue
  • Example: 2500 gram None
• host-associated➞host_height _0..1
  • Description: The height of subject
  • Range: QuantityValue
  • Example: 0.1 meter None
• host-associated➞host_length _0..1
  • Description: The length of subject
  • Range: QuantityValue
  • Example: 1 meter None
• host-associated➞host_diet _0..*
  • Description: Type of diet depending on the host, for animals omnivore, herbivore etc., for humans high-fat, meditteranean etc.; can include multiple diet types
  • Range: String
  • Example: herbivore None
• host-associated➞host_last_meal _0..*
  • Description: Content of last meal and time since feeding; can include multiple values
  • Range: String
  • Example: corn feed;P2H None
• host-associated➞host_growth_cond _0..1
  • Description: Literature reference giving growth conditions of the host
  • Range: String
  • Example: https://academic.oup.com/icesjms/article/68/2/349/617247 None
• host-associated➞host_substrate _0..1
  • Description: The growth substrate of the host.
  • Range: String
  • Example: rock None
• host-associated➞host_family_relation _0..*
  • Description: Familial relationships to other hosts in the same study; can include multiple relationships
  • Range: String
  • Example: offspring;Mussel25 None
• host-associated➞host_infra_spec_name _0..1
  • Description: Taxonomic information about the host below subspecies level
  • Range: String
  • Example: borealis None
• host-associated➞host_infra_spec_rank _0..1
  • Description: Taxonomic rank information about the host below subspecies level, such as variety, form, rank etc.
  • Range: String
  • Example: subspecies None
• host-associated➞host_subspecf_genlin _0..*
  • Description: Information about the genetic distinctness of the host organism below the subspecies level e.g., serovar, serotype, biotype, ecotype, variety, cultivar, or any relevant genetic typing schemes like Group I plasmid. Subspecies should not be recorded in this term, but in the NCBI taxonomy. Supply both the lineage name and the lineage rank separated by a colon, e.g., biovar:abc123.
  • Range: String
  • Example: subvariety:glabrum None
• host-associated➞host_genotype _0..1
  • Description: Observed genotype
  • Range: String
  • Example: C57BL/6 None
• host-associated➞host_phenotype _0..1
  • Description: Phenotype of human or other host. For phenotypic quality ontology (pato) (v 2018-03-27) terms, please see http://purl.bioontology.org/ontology/pato. For Human Phenotype Ontology (HP) (v 2018-06-13) please see http://purl.bioontology.org/ontology/HP
  • Range: String
  • Example: elongated [PATO:0001154] None
• host-associated➞host_body_temp _0..1
  • Description: Core body temperature of the host when sample was collected
  • Range: QuantityValue
  • Example: 15 degree Celsius None
• host-associated➞host_dry_mass _0..1
  • Description: Measurement of dry mass
  • Range: QuantityValue
  • Example: 500 gram None
• host-associated➞blood_press_diast _0..1
  • Description: Resting diastolic blood pressure, measured as mm mercury
  • Range: QuantityValue
  • Example: None
• host-associated➞blood_press_syst _0..1
  • Description: Resting systolic blood pressure, measured as mm mercury
  • Range: QuantityValue
  • Example: None
• host-associated➞host_color _0..1
  • Description: The color of host
  • Range: String
  • Example: None
• host-associated➞host_shape _0..1
  • Description: Morphological shape of host
  • Range: String
  • Example: round None
• host-associated➞gravidity _0..1
  • Description: Whether or not subject is gravid, and if yes date due or date post-conception, specifying which is used
  • Range: String
  • Example: yes;due date:2018-05-11 None
• host-associated➞perturbation _0..*
  • Description: Type of perturbation, e.g. chemical administration, physical disturbance, etc., coupled with perturbation regimen including how many times the perturbation was repeated, how long each perturbation lasted, and the start and end time of the entire perturbation period; can include multiple perturbation types
  • Range: String
  • Example: antibiotic addition;R2/2018-05-11T14:30Z/2018-05-11T19:30Z/P1H30M None
• host-associated➞samp_salinity _0..1
  • Description: Salinity is the total concentration of all dissolved salts in a liquid or solid (in the form of an extract obtained by centrifugation) sample. While salinity can be measured by a complete chemical analysis, this method is difficult and time consuming. More often, it is instead derived from the conductivity measurement. This is known as practical salinity. These derivations compare the specific conductance of the sample to a salinity standard such as seawater
  • Range: QuantityValue
  • Example: 1 milligram per liter None
• host-associated➞salinity _0..1
  • Description: The total concentration of all dissolved salts in a liquid or solid sample. While salinity can be measured by a complete chemical analysis, this method is difficult and time consuming. More often, it is instead derived from the conductivity measurement. This is known as practical salinity. These derivations compare the specific conductance of the sample to a salinity standard such as seawater.
  • Range: QuantityValue
  • Example: 25 practical salinity unit None
• host-associated➞oxy_stat_samp _0..1
  • Description: Oxygenation status of sample
  • Range: oxy_stat_samp_enum
  • Example: aerobic None
• host-associated➞organism_count _0..*
  • Description: Total cell count of any organism (or group of organisms) per gram, volume or area of sample, should include name of organism followed by count. The method that was used for the enumeration (e.g. qPCR, atp, mpn, etc.) Should also be provided. (example: total prokaryotes; 3.5e7 cells per ml; qpcr)
  • Range: organism_count_enum
  • Example: total prokaryotes;3.5e7 cells per milliliter;qPCR None
• host-associated➞samp_store_temp _0..1
  • Description: Temperature at which sample was stored, e.g. -80 degree Celsius
  • Range: QuantityValue
  • Example: -80 degree Celsius None
• host-associated➞samp_store_dur _0..1
  • Description: Duration for which the sample was stored
  • Range: String
  • Example: P1Y6M None
• host-associated➞samp_store_loc _0..1
  • Description: Location at which sample was stored, usually name of a specific freezer/room
  • Range: String
  • Example: Freezer no:5 None
• host-associated➞host_symbiont _0..*
  • Description: The taxonomic name of the organism(s) found living in mutualistic, commensalistic, or parasitic symbiosis with the specific host.
  • Range: String
  • Example: flukeworms None
• host-associated➞misc_param _0..*
  • Description: Any other measurement performed or parameter collected, that is not listed here
  • Range: String
  • Example: Bicarbonate ion concentration;2075 micromole per kilogram None
• host-associated➞samp_name _1..1
  • Description: A local identifier or name that for the material sample used for extracting nucleic acids, and subsequent sequencing. It can refer either to the original material collected or to any derived sub-samples. It can have any format, but we suggest that you make it concise, unique and consistent within your lab, and as informative as possible. INSDC requires every sample name from a single Submitter to be unique. Use of a globally unique identifier for the field source_mat_id is recommended in addition to sample_name.
  • Range: String
  • Example: ISDsoil1 None
• host-associated➞project_name _1..1
  • Description: Name of the project within which the sequencing was organized
  • Range: String
  • Example: Forest soil metagenome None
• host-associated➞host_disease_stat _0..1
  • Description: List of diseases with which the host has been diagnosed; can include multiple diagnoses. The value of the field depends on host; for humans the terms should be chosen from the DO (Human Disease Ontology) at https://www.disease-ontology.org, non-human host diseases are free text
  • Range: String
  • Example: rabies [DOID:11260] None
• host-associated➞samp_vol_we_dna_ext _0..1
  • Description: Volume (ml) or mass (g) of total collected sample processed for DNA extraction. Note: total sample collected should be entered under the term Sample Size (MIXS:0000001).
  • Range: QuantityValue
  • Example: 1500 milliliter None

Mixed in from MIUVIG:

• MIUVIG➞submitted_to_insdc _1..1
  • Description: Depending on the study (large-scale e.g. done with next generation sequencing technology, or small-scale) sequences have to be submitted to SRA (Sequence Read Archive), DRA (DDBJ Read Archive) or via the classical Webin/Sequin systems to Genbank, ENA and DDBJ. Although this field is mandatory, it is meant as a self-test field, therefore it is not necessary to include this field in contextual data submitted to databases
  • Range: String
  • Example: yes None

Mixed in from MIUVIG:

• MIUVIG➞investigation_type _1..1
  • Description: Nucleic Acid Sequence Report is the root element of all MIGS/MIMS compliant reports as standardized by Genomic Standards Consortium. This field is either eukaryote,bacteria,virus,plasmid,organelle, metagenome,mimarks-survey, mimarks-specimen, metatranscriptome, single amplified genome, metagenome-assembled genome, or uncultivated viral genome
  • Range: investigation_type_enum
  • Example: metagenome None

Mixed in from MIUVIG:

• MIUVIG➞samp_taxon_id _1..1
  • Description: NCBI taxon id of the sample. Maybe be a single taxon or mixed taxa sample. Use 'synthetic metagenome’ for mock community/positive controls, or 'blank sample' for negative controls.
  • Range: String
  • Example: Gut Metagenome [NCBI:txid749906] None

Mixed in from MIUVIG:

• MIUVIG➞experimental_factor _0..1
  • Description: Experimental factors are essentially the variable aspects of an experiment design which can be used to describe an experiment, or set of experiments, in an increasingly detailed manner. This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). For a browser of EFO (v 2.95) terms, please see http://purl.bioontology.org/ontology/EFO; for a browser of OBI (v 2018-02-12) terms please see http://purl.bioontology.org/ontology/OBI
  • Range: String
  • Example: time series design [EFO:EFO_0001779] None

Mixed in from MIUVIG:

• MIUVIG➞neg_cont_type _0..1
  • Description: The substance or equipment used as a negative control in an investigation
  • Range: neg_cont_type_enum
  • Example: None

Mixed in from MIUVIG:

• MIUVIG➞pos_cont_type _0..1
  • Description: The substance, mixture, product, or apparatus used to verify that a process which is part of an investigation delivers a true positive.
  • Range: String
  • Example: None

Mixed in from MIUVIG:

• MIUVIG➞env_package _0..1
  • Description: MIxS extension for reporting of measurements and observations obtained from one or more of the environments where the sample was obtained. All environmental packages listed here are further defined in separate subtables. By giving the name of the environmental package, a selection of fields can be made from the subtables and can be reported
  • Range: env_package_enum
  • Example: soil None

Mixed in from MIUVIG:

• MIUVIG➞estimated_size _0..1
  • Description: The estimated size of the genome prior to sequencing. Of particular importance in the sequencing of (eukaryotic) genome which could remain in draft form for a long or unspecified period.
  • Range: String
  • Example: 300000 bp None

Mixed in from MIUVIG:

• MIUVIG➞ref_biomaterial _0..1
  • Description: Primary publication if isolated before genome publication; otherwise, primary genome report.
  • Range: String
  • Example: doi:10.1016/j.syapm.2018.01.009 None

Mixed in from MIUVIG:

• MIUVIG➞source_mat_id _0..1
  • Description: A unique identifier assigned to a material sample (as defined by http://rs.tdwg.org/dwc/terms/materialSampleID, and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing. The identifier can refer either to the original material collected or to any derived sub-samples. The INSDC qualifiers /specimen_voucher, /bio_material, or /culture_collection may or may not share the same value as the source_mat_id field. For instance, the /specimen_voucher qualifier and source_mat_id may both contain 'UAM:Herps:14' , referring to both the specimen voucher and sampled tissue with the same identifier. However, the /culture_collection qualifier may refer to a value from an initial culture (e.g. ATCC:11775) while source_mat_id would refer to an identifier from some derived culture from which the nucleic acids were extracted (e.g. xatc123 or ark:/2154/R2).
  • Range: String
  • Example: MPI012345 None

Mixed in from MIUVIG:

• MIUVIG➞pathogenicity _0..1
  • Description: To what is the entity pathogenic
  • Range: String
  • Example: human, animal, plant, fungi, bacteria None

Mixed in from MIUVIG:

• MIUVIG➞biotic_relationship _0..1
  • Description: Description of relationship(s) between the subject organism and other organism(s) it is associated with. E.g., parasite on species X; mutualist with species Y. The target organism is the subject of the relationship, and the other organism(s) is the object
  • Range: biotic_relationship_enum
  • Example: free living None

Mixed in from MIUVIG:

• MIUVIG➞specific_host _0..1
  • Description: Report the host's taxonomic name and/or NCBI taxonomy ID.
  • Range: String
  • Example: Homo sapiens and/or 9606 None

Mixed in from MIUVIG:

• MIUVIG➞host_spec_range _0..1
  • Description: The range and diversity of host species that an organism is capable of infecting, defined by NCBI taxonomy identifier.
  • Range: Integer
  • Example: 9606 None

Mixed in from MIUVIG:

• MIUVIG➞samp_collec_device _0..1
  • Description: The device used to collect an environmental sample. This field accepts terms listed under environmental sampling device (http://purl.obolibrary.org/obo/ENVO). This field also accepts terms listed under specimen collection device (http://purl.obolibrary.org/obo/GENEPIO_0002094).
  • Range: String
  • Example: swab, biopsy, niskin bottle, push core, drag swab [GENEPIO:0002713] None

Mixed in from MIUVIG:

• MIUVIG➞samp_collec_method _0..1
  • Description: The method employed for collecting the sample.
  • Range: String
  • Example: swabbing None

Mixed in from MIUVIG:

• MIUVIG➞samp_mat_process _0..1
  • Description: A brief description of any processing applied to the sample during or after retrieving the sample from environment, or a link to the relevant protocol(s) performed.
  • Range: String
  • Example: filtering of seawater, storing samples in ethanol None

Mixed in from MIUVIG:

• MIUVIG➞size_frac _0..1
  • Description: Filtering pore size used in sample preparation
  • Range: String
  • Example: 0-0.22 micrometer None

Mixed in from MIUVIG:

• MIUVIG➞samp_size _0..1
  • Description: The total amount or size (volume (ml), mass (g) or area (m2) ) of sample collected.
  • Range: QuantityValue
  • Example: 5 liter None

Mixed in from MIUVIG:

• MIUVIG➞source_uvig _1..1
  • Description: Type of dataset from which the UViG was obtained
  • Range: source_uvig_enum
  • Example: viral fraction metagenome (virome) None

Mixed in from MIUVIG:

• MIUVIG➞virus_enrich_appr _1..1
  • Description: List of approaches used to enrich the sample for viruses, if any
  • Range: virus_enrich_appr_enum
  • Example: filtration + FeCl Precipitation + ultracentrifugation + DNAse None

Mixed in from MIUVIG:

• MIUVIG➞nucl_acid_ext _0..1
  • Description: A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample
  • Range: String
  • Example: https://mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf None

Mixed in from MIUVIG:

• MIUVIG➞nucl_acid_amp _0..1
  • Description: A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the enzymatic amplification (PCR, TMA, NASBA) of specific nucleic acids
  • Range: String
  • Example: https://phylogenomics.me/protocols/16s-pcr-protocol/ None

Mixed in from MIUVIG:

• MIUVIG➞lib_size _0..1
  • Description: Total number of clones in the library prepared for the project
  • Range: Integer
  • Example: 50 None

Mixed in from MIUVIG:

• MIUVIG➞lib_reads_seqd _0..1
  • Description: Total number of clones sequenced from the library
  • Range: Integer
  • Example: 20 None

Mixed in from MIUVIG:

• MIUVIG➞lib_layout _0..1
  • Description: Specify whether to expect single, paired, or other configuration of reads
  • Range: lib_layout_enum
  • Example: paired None

Mixed in from MIUVIG:

• MIUVIG➞lib_vector _0..1
  • Description: Cloning vector type(s) used in construction of libraries
  • Range: String
  • Example: Bacteriophage P1 None

Mixed in from MIUVIG:

• MIUVIG➞lib_screen _0..1
  • Description: Specific enrichment or screening methods applied before and/or after creating libraries
  • Range: String
  • Example: enriched, screened, normalized None

Mixed in from MIUVIG:

• MIUVIG➞mid _0..1
  • Description: Molecular barcodes, called Multiplex Identifiers (MIDs), that are used to specifically tag unique samples in a sequencing run. Sequence should be reported in uppercase letters
  • Range: String
  • Example: GTGAATAT None

Mixed in from MIUVIG:

• MIUVIG➞adapters _0..1
  • Description: Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters
  • Range: String
  • Example: AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT None

Mixed in from MIUVIG:

• MIUVIG➞seq_meth _1..1
  • Description: Sequencing machine used. Where possible the term should be taken from the OBI list of DNA sequencers (http://purl.obolibrary.org/obo/OBI_0400103).
  • Range: String
  • Example: 454 Genome Sequencer FLX [OBI:0000702] None

Mixed in from MIUVIG:

• MIUVIG➞tax_ident _0..1
  • Description: The phylogenetic marker(s) used to assign an organism name to the SAG or MAG
  • Range: tax_ident_enum
  • Example: other: rpoB gene None

Mixed in from MIUVIG:

• MIUVIG➞assembly_qual _1..1
  • Description: The assembly quality category is based on sets of criteria outlined for each assembly quality category. For MISAG/MIMAG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities with a consensus error rate equivalent to Q50 or better. High Quality Draft:Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs. Medium Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Low Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to total assembly size, number of contigs, contig N50/L50, and maximum contig length. For MIUVIG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities, with extensive manual review and editing to annotate putative gene functions and transcriptional units. High-quality draft genome: One or multiple fragments, totaling ≥ 90% of the expected genome or replicon sequence or predicted complete. Genome fragment(s): One or multiple fragments, totalling < 90% of the expected genome or replicon sequence, or for which no genome size could be estimated
  • Range: assembly_qual_enum
  • Example: High-quality draft genome None

Mixed in from MIUVIG:

• MIUVIG➞assembly_name _0..1
  • Description: Name/version of the assembly provided by the submitter that is used in the genome browsers and in the community
  • Range: String
  • Example: HuRef, JCVI_ISG_i3_1.0 None

Mixed in from MIUVIG:

• MIUVIG➞assembly_software _1..1
  • Description: Tool(s) used for assembly, including version number and parameters
  • Range: String
  • Example: metaSPAdes;3.11.0;kmer set 21,33,55,77,99,121, default parameters otherwise None

Mixed in from MIUVIG:

• MIUVIG➞annot _0..1
  • Description: Tool used for annotation, or for cases where annotation was provided by a community jamboree or model organism database rather than by a specific submitter
  • Range: String
  • Example: prokka None

Mixed in from MIUVIG:

• MIUVIG➞number_contig _1..1
  • Description: Total number of contigs in the cleaned/submitted assembly that makes up a given genome, SAG, MAG, or UViG
  • Range: Integer
  • Example: 40 None

Mixed in from MIUVIG:

• MIUVIG➞feat_pred _0..1
  • Description: Method used to predict UViGs features such as ORFs, integration site, etc.
  • Range: String
  • Example: Prodigal;2.6.3;default parameters None

Mixed in from MIUVIG:

• MIUVIG➞ref_db _0..1
  • Description: List of database(s) used for ORF annotation, along with version number and reference to website or publication
  • Range: String
  • Example: pVOGs;5;http://dmk-brain.ecn.uiowa.edu/pVOGs/ Grazziotin et al. 2017 doi:10.1093/nar/gkw975 None

Mixed in from MIUVIG:

• MIUVIG➞sim_search_meth _0..1
  • Description: Tool used to compare ORFs with database, along with version and cutoffs used
  • Range: String
  • Example: HMMER3;3.1b2;hmmsearch, cutoff of 50 on score None

Mixed in from MIUVIG:

• MIUVIG➞tax_class _0..1
  • Description: Method used for taxonomic classification, along with reference database used, classification rank, and thresholds used to classify new genomes
  • Range: String
  • Example: vConTACT vContact2 (references from NCBI RefSeq v83, genus rank classification, default parameters) None

Mixed in from MIUVIG:

• MIUVIG➞trnas _0..1
  • Description: The total number of tRNAs identified from the SAG or MAG
  • Range: Integer
  • Example: 18 None

Mixed in from MIUVIG:

• MIUVIG➞trna_ext_software _0..1
  • Description: Tools used for tRNA identification
  • Range: String
  • Example: infernal;v2;default parameters None

Mixed in from MIUVIG:

• MIUVIG➞compl_score _0..1
  • Description: Completeness score is typically based on either the fraction of markers found as compared to a database or the percent of a genome found as compared to a closely related reference genome. High Quality Draft: >90%, Medium Quality Draft: >50%, and Low Quality Draft: < 50% should have the indicated completeness scores
  • Range: compl_score_enum
  • Example: med;60% None

Mixed in from MIUVIG:

• MIUVIG➞compl_software _0..1
  • Description: Tools used for completion estimate, i.e. checkm, anvi'o, busco
  • Range: String
  • Example: checkm None

Mixed in from MIUVIG:

• MIUVIG➞compl_appr _0..1
  • Description: The approach used to determine the completeness of a given genomic assembly, which would typically make use of a set of conserved marker genes or a closely related reference genome. For UViG completeness, include reference genome or group used, and contig feature suggesting a complete genome
  • Range: compl_appr_enum
  • Example: other: UViG length compared to the average length of reference genomes from the P22virus genus (NCBI RefSeq v83) None

Mixed in from MIUVIG:

• MIUVIG➞sort_tech _0..1
  • Description: Method used to sort/isolate cells or particles of interest
  • Range: sort_tech_enum
  • Example: optical manipulation None

Mixed in from MIUVIG:

• MIUVIG➞single_cell_lysis_appr _0..1
  • Description: Method used to free DNA from interior of the cell(s) or particle(s)
  • Range: single_cell_lysis_appr_enum
  • Example: enzymatic None

Mixed in from MIUVIG:

• MIUVIG➞single_cell_lysis_prot _0..1
  • Description: Name of the kit or standard protocol used for cell(s) or particle(s) lysis
  • Range: String
  • Example: ambion single cell lysis kit None

Mixed in from MIUVIG:

• MIUVIG➞wga_amp_appr _0..1
  • Description: Method used to amplify genomic DNA in preparation for sequencing
  • Range: String
  • Example: mda based None

Mixed in from MIUVIG:

• MIUVIG➞wga_amp_kit _0..1
  • Description: Kit used to amplify genomic DNA in preparation for sequencing
  • Range: String
  • Example: qiagen repli-g None

Mixed in from MIUVIG:

• MIUVIG➞bin_param _0..1
  • Description: The parameters that have been applied during the extraction of genomes from metagenomic datasets
  • Range: bin_param_enum
  • Example: coverage and kmer None

Mixed in from MIUVIG:

• MIUVIG➞bin_software _0..1
  • Description: Tool(s) used for the extraction of genomes from metagenomic datasets, where possible include a product ID (PID) of the tool(s) used.
  • Range: String
  • Example: MetaCluster-TA (RRID:SCR_004599), MaxBin (biotools:maxbin) None

Mixed in from MIUVIG:

• MIUVIG➞reassembly_bin _0..1
  • Description: Has an assembly been performed on a genome bin extracted from a metagenomic assembly?
  • Range: String
  • Example: no None

Mixed in from MIUVIG:

• MIUVIG➞mag_cov_software _0..1
  • Description: Tool(s) used to determine the genome coverage if coverage is used as a binning parameter in the extraction of genomes from metagenomic datasets
  • Range: mag_cov_software_enum
  • Example: bbmap None

Mixed in from MIUVIG:

• MIUVIG➞vir_ident_software _1..1
  • Description: Tool(s) used for the identification of UViG as a viral genome, software or protocol name including version number, parameters, and cutoffs used
  • Range: String
  • Example: VirSorter; 1.0.4; Virome database, category 2 None

Mixed in from MIUVIG:

• MIUVIG➞pred_genome_type _1..1
  • Description: Type of genome predicted for the UViG
  • Range: pred_genome_type_enum
  • Example: dsDNA None

Mixed in from MIUVIG:

• MIUVIG➞pred_genome_struc _1..1
  • Description: Expected structure of the viral genome
  • Range: pred_genome_struc_enum
  • Example: non-segmented None

Mixed in from MIUVIG:

• MIUVIG➞detec_type _1..1
  • Description: Type of UViG detection
  • Range: String
  • Example: independent sequence (UViG) None

Mixed in from MIUVIG:

• MIUVIG➞otu_class_appr _0..1
  • Description: Cutoffs and approach used when clustering “species-level” OTUs. Note that results from standard 95% ANI / 85% AF clustering should be provided alongside OTUS defined from another set of thresholds, even if the latter are the ones primarily used during the analysis
  • Range: String
  • Example: 95% ANI;85% AF; greedy incremental clustering None

Mixed in from MIUVIG:

• MIUVIG➞otu_seq_comp_appr _0..1
  • Description: Tool and thresholds used to compare sequences when computing "species-level" OTUs
  • Range: String
  • Example: blastn;2.6.0+;e-value cutoff: 0.001 None

Mixed in from MIUVIG:

• MIUVIG➞otu_db _0..1
  • Description: Reference database (i.e. sequences not generated as part of the current study) used to cluster new genomes in "species-level" OTUs, if any
  • Range: String
  • Example: NCBI Viral RefSeq;83 None

Mixed in from MIUVIG:

• MIUVIG➞host_pred_appr _0..1
  • Description: Tool or approach used for host prediction
  • Range: host_pred_appr_enum
  • Example: CRISPR spacer match None

Mixed in from MIUVIG:

• MIUVIG➞host_pred_est_acc _0..1
  • Description: For each tool or approach used for host prediction, estimated false discovery rates should be included, either computed de novo or from the literature
  • Range: String
  • Example: CRISPR spacer match: 0 or 1 mismatches, estimated 8% FDR at the host genus rank (Edwards et al. 2016 doi:10.1093/femsre/fuv048) None

Mixed in from MIUVIG:

• MIUVIG➞associated resource _0..1
  • Description: A related resource that is referenced, cited, or otherwise associated to the sequence.
  • Range: String
  • Example: http://www.earthmicrobiome.org/ None

Mixed in from MIUVIG:

• MIUVIG➞sop _0..1
  • Description: Standard operating procedures used in assembly and/or annotation of genomes, metagenomes or environmental sequences
  • Range: String
  • Example: http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/ None